Incidental Mutation 'R2292:Arhgap35'
ID 245032
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene Name Rho GTPase activating protein 35
Synonyms p190A, 6430596G11Rik, p190RhoGAP, Grlf1, P190 RhoGAP
MMRRC Submission 040291-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2292 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 16228398-16349313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16297476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 530 (F530I)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
AlphaFold Q91YM2
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: F530I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: F530I

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: F530I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: F530I

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Meta Mutation Damage Score 0.3516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,562,483 (GRCm39) I370T probably benign Het
A2m A G 6: 121,650,518 (GRCm39) T1209A possibly damaging Het
Als2 T C 1: 59,226,544 (GRCm39) Q920R probably damaging Het
Arhgap20 T A 9: 51,760,743 (GRCm39) Y829N possibly damaging Het
Arid4a G T 12: 71,108,315 (GRCm39) G40V probably damaging Het
Ascc2 T C 11: 4,629,352 (GRCm39) probably benign Het
Cacna1b C T 2: 24,496,632 (GRCm39) V2312I probably benign Het
Dctn6 T C 8: 34,559,679 (GRCm39) T159A probably benign Het
Ddx55 G T 5: 124,706,140 (GRCm39) A522S probably benign Het
Dnah6 G A 6: 72,998,092 (GRCm39) T4110I probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Dym A G 18: 75,332,283 (GRCm39) T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 (GRCm39) Y138H probably damaging Het
Fgd4 A T 16: 16,253,864 (GRCm39) C568S possibly damaging Het
Fkbp4 A C 6: 128,413,625 (GRCm39) V6G probably damaging Het
Flg2 A T 3: 93,127,984 (GRCm39) S2299C unknown Het
Gdf2 A T 14: 33,667,145 (GRCm39) N289I possibly damaging Het
Gpr182 A G 10: 127,586,051 (GRCm39) I300T possibly damaging Het
Iqcg A G 16: 32,870,253 (GRCm39) V80A probably benign Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lyst T G 13: 13,915,080 (GRCm39) F3258C probably damaging Het
Map3k12 T C 15: 102,408,574 (GRCm39) E870G probably damaging Het
Mphosph10 G A 7: 64,035,519 (GRCm39) P384L probably damaging Het
Ncoa4 T G 14: 31,895,413 (GRCm39) L179R probably damaging Het
Nlrp1c-ps A G 11: 71,137,188 (GRCm39) noncoding transcript Het
Nwd2 A T 5: 63,962,917 (GRCm39) M834L probably benign Het
Or10a49 A T 7: 108,468,223 (GRCm39) M46K probably benign Het
Or2w6 A G 13: 21,843,001 (GRCm39) M164T probably damaging Het
Pccb T C 9: 100,876,685 (GRCm39) E266G probably benign Het
Pcdhb2 T A 18: 37,430,297 (GRCm39) probably null Het
Pramel25 T C 4: 143,520,446 (GRCm39) I66T probably benign Het
Prdm13 A C 4: 21,683,914 (GRCm39) I119S unknown Het
Tchh A G 3: 93,349,689 (GRCm39) Y18C probably damaging Het
Tmem192 T C 8: 65,411,998 (GRCm39) V59A probably damaging Het
Trak2 A T 1: 58,974,916 (GRCm39) F92Y probably damaging Het
Trappc11 C T 8: 47,958,771 (GRCm39) G40D probably damaging Het
Ttc23 A T 7: 67,319,535 (GRCm39) I132F probably benign Het
Ttc9b A G 7: 27,355,405 (GRCm39) D225G probably benign Het
Ubr3 G T 2: 69,727,604 (GRCm39) probably benign Het
Vmn2r75 A C 7: 85,798,144 (GRCm39) C556W probably damaging Het
Zbtb41 T C 1: 139,368,097 (GRCm39) V595A probably damaging Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16,298,340 (GRCm39) missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16,295,625 (GRCm39) missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16,298,399 (GRCm39) missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16,298,192 (GRCm39) missense probably benign
IGL01922:Arhgap35 APN 7 16,298,180 (GRCm39) missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16,297,128 (GRCm39) missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16,296,980 (GRCm39) missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16,297,590 (GRCm39) missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16,296,305 (GRCm39) missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16,296,803 (GRCm39) missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16,231,580 (GRCm39) makesense probably null
PIT4382001:Arhgap35 UTSW 7 16,297,794 (GRCm39) missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16,295,536 (GRCm39) missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16,295,917 (GRCm39) missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16,297,206 (GRCm39) missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16,295,874 (GRCm39) missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16,297,058 (GRCm39) missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16,231,950 (GRCm39) splice site probably null
R3079:Arhgap35 UTSW 7 16,296,501 (GRCm39) missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16,297,647 (GRCm39) missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16,299,000 (GRCm39) missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16,298,663 (GRCm39) missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16,297,511 (GRCm39) missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16,232,551 (GRCm39) missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16,299,059 (GRCm39) missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16,245,112 (GRCm39) splice site probably null
R5175:Arhgap35 UTSW 7 16,296,524 (GRCm39) missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16,296,849 (GRCm39) missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16,297,414 (GRCm39) missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16,297,392 (GRCm39) missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16,297,568 (GRCm39) missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16,297,392 (GRCm39) missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16,296,224 (GRCm39) missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16,299,038 (GRCm39) missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16,299,038 (GRCm39) missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16,296,491 (GRCm39) missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16,295,652 (GRCm39) missense probably benign
R7276:Arhgap35 UTSW 7 16,298,493 (GRCm39) missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16,296,132 (GRCm39) missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16,298,786 (GRCm39) missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16,296,573 (GRCm39) missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16,295,453 (GRCm39) missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16,296,244 (GRCm39) missense probably benign 0.00
R8873:Arhgap35 UTSW 7 16,295,415 (GRCm39) missense possibly damaging 0.92
R8956:Arhgap35 UTSW 7 16,348,404 (GRCm39) start gained probably benign
R9163:Arhgap35 UTSW 7 16,295,549 (GRCm39) missense possibly damaging 0.94
R9507:Arhgap35 UTSW 7 16,297,343 (GRCm39) missense probably benign 0.31
R9667:Arhgap35 UTSW 7 16,296,914 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAGGTCAGACAGAGAGTTCTTC -3'
(R):5'- AATGAAGACTTCTACCAGTGGC -3'

Sequencing Primer
(F):5'- CAGACAGAGAGTTCTTCTGATTCCG -3'
(R):5'- TGGAAGAATCTGTGTACATGGACATC -3'
Posted On 2014-10-30