Incidental Mutation 'R2920:Zbtb1'
ID 255488
Institutional Source Beutler Lab
Gene Symbol Zbtb1
Ensembl Gene ENSMUSG00000033454
Gene Name zinc finger and BTB domain containing 1
Synonyms C430003J21Rik
MMRRC Submission 040505-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.712) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 76370266-76396950 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76385845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 202 (S202T)
Ref Sequence ENSEMBL: ENSMUSP00000041955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042779]
AlphaFold Q91VL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000042779
AA Change: S202T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041955
Gene: ENSMUSG00000033454
AA Change: S202T

DomainStartEndE-ValueType
BTB 24 121 1.01e-16 SMART
ZnF_C2H2 216 242 2.17e1 SMART
low complexity region 359 368 N/A INTRINSIC
ZnF_C2H2 421 443 3.38e1 SMART
ZnF_C2H2 534 554 1.4e1 SMART
ZnF_C2H2 578 600 2.02e-1 SMART
ZnF_C2H2 606 628 6.23e-2 SMART
ZnF_C2H2 634 656 1.62e0 SMART
ZnF_C2H2 662 684 1.08e-1 SMART
ZnF_C2H2 686 709 1.36e-2 SMART
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]
Allele List at MGI

www.informatics.jax.org/javawi2/servlet/WIFetch
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Other mutations in Zbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01891:Zbtb1 APN 12 76385661 missense probably damaging 1.00
IGL02097:Zbtb1 APN 12 76386597 missense probably damaging 1.00
IGL02328:Zbtb1 APN 12 76386676 missense possibly damaging 0.75
IGL02496:Zbtb1 APN 12 76385395 missense possibly damaging 0.76
IGL03270:Zbtb1 APN 12 76385515 missense possibly damaging 0.59
Limited UTSW 12 76385827 missense probably damaging 0.99
Occasional UTSW 12 76387010 missense probably damaging 1.00
Old_friend UTSW 12 76385891 missense probably damaging 0.96
scant UTSW 12 76385461 missense probably damaging 1.00
R0893:Zbtb1 UTSW 12 76385339 missense probably damaging 1.00
R1317:Zbtb1 UTSW 12 76386799 missense probably benign 0.00
R1525:Zbtb1 UTSW 12 76386432 missense probably benign
R1761:Zbtb1 UTSW 12 76385821 nonsense probably null
R5307:Zbtb1 UTSW 12 76386240 missense probably damaging 1.00
R5718:Zbtb1 UTSW 12 76386924 missense probably benign
R5975:Zbtb1 UTSW 12 76386275 missense possibly damaging 0.88
R6484:Zbtb1 UTSW 12 76385891 missense probably damaging 0.96
R6493:Zbtb1 UTSW 12 76386473 missense probably benign
R6513:Zbtb1 UTSW 12 76385830 missense possibly damaging 0.55
R6904:Zbtb1 UTSW 12 76386211 nonsense probably null
R6948:Zbtb1 UTSW 12 76385827 missense probably damaging 0.99
R8725:Zbtb1 UTSW 12 76385872 missense probably damaging 1.00
R9202:Zbtb1 UTSW 12 76387010 missense probably damaging 1.00
R9303:Zbtb1 UTSW 12 76385999 missense probably damaging 0.98
R9305:Zbtb1 UTSW 12 76385999 missense probably damaging 0.98
X0028:Zbtb1 UTSW 12 76385299 missense probably damaging 1.00
Z1191:Zbtb1 UTSW 12 76385249 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATGAAGACACGGTGGC -3'
(R):5'- GTCCGGCTGTGCAGAAAATG -3'

Sequencing Primer
(F):5'- CACGGTGGCTAGAAATGGC -3'
(R):5'- GAATCCTTTTCAGCAAGTTCAGC -3'
Posted On 2014-12-29