Mutagenetix > Incidental Mutations

Incidental Mutation 'R2920:Il12rb2'

255465

Institutional Source

Beutler Lab

Gene Symbol

Il12rb2

Ensembl Gene

ENSMUSG00000018341

Gene Name

interleukin 12 receptor, beta 2

Synonyms

IL-12RB2, Ifnm, A930027I18Rik

MMRRC Submission

040505-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67291318-67376188 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 67360568 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 110 (V110I)

Ref Sequence

ENSEMBL: ENSMUSP00000010605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018485]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018485
AA Change: V110I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: V110I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Lep_receptor_Ig	28	120	6.4e-20	PFAM
FN3	137	225	2.41e0	SMART
FN3	240	320	3.4e-4	SMART
Blast:FN3	340	434	2e-40	BLAST
FN3	436	525	3.17e-4	SMART
FN3	534	622	6.45e-5	SMART

Meta Mutation Damage Score

0.2940

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Chl1	C	A	6: 103,695,343	T531K	probably damaging	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Crebbp	A	G	16: 4,119,082	V343A	probably damaging	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo10	G	T	15: 25,801,140	V1472L	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rint1	A	G	5: 23,805,402	E203G	probably benign	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc14a2	G	T	18: 78,158,297	S669*	probably null	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Slc4a5	T	C	6: 83,264,387	L215P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Il12rb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00584:Il12rb2	APN	6	67357692	missense	probably damaging	0.98
IGL00767:Il12rb2	APN	6	67303562	missense	possibly damaging	0.63
IGL00835:Il12rb2	APN	6	67360567	missense	probably damaging	0.99
IGL00864:Il12rb2	APN	6	67336754	missense	probably benign
IGL00965:Il12rb2	APN	6	67360577	missense	probably damaging	0.98
IGL01161:Il12rb2	APN	6	67361865	splice site	probably benign
IGL01980:Il12rb2	APN	6	67360535	missense	probably benign
IGL02246:Il12rb2	APN	6	67308956	critical splice donor site	probably null
IGL02807:Il12rb2	APN	6	67351316	missense	probably damaging	1.00
R0003:Il12rb2	UTSW	6	67316286	missense	probably damaging	1.00
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0022:Il12rb2	UTSW	6	67298919	missense	probably damaging	0.99
R0079:Il12rb2	UTSW	6	67361905	missense	probably benign	0.00
R0462:Il12rb2	UTSW	6	67303610	missense	possibly damaging	0.95
R0709:Il12rb2	UTSW	6	67298904	splice site	probably benign
R0828:Il12rb2	UTSW	6	67356707	missense	probably benign
R1051:Il12rb2	UTSW	6	67356735	missense	probably benign
R1191:Il12rb2	UTSW	6	67298216	missense	possibly damaging	0.90
R1446:Il12rb2	UTSW	6	67309143	missense	probably benign
R1559:Il12rb2	UTSW	6	67356592	missense	probably benign	0.12
R1677:Il12rb2	UTSW	6	67303501	missense	probably damaging	1.00
R1689:Il12rb2	UTSW	6	67336760	missense	probably benign	0.01
R1907:Il12rb2	UTSW	6	67295286	nonsense	probably null
R1952:Il12rb2	UTSW	6	67292316	missense	probably damaging	0.99
R2048:Il12rb2	UTSW	6	67360545	missense	probably benign	0.05
R2074:Il12rb2	UTSW	6	67360552	missense	probably damaging	1.00
R2351:Il12rb2	UTSW	6	67361944	nonsense	probably null
R2358:Il12rb2	UTSW	6	67298195	missense	probably damaging	0.96
R2680:Il12rb2	UTSW	6	67354805	missense	possibly damaging	0.94
R3107:Il12rb2	UTSW	6	67360798	missense	probably damaging	1.00
R4420:Il12rb2	UTSW	6	67316410	splice site	probably null
R4838:Il12rb2	UTSW	6	67309137	missense	probably damaging	1.00
R5391:Il12rb2	UTSW	6	67292420	missense	probably benign	0.24
R5532:Il12rb2	UTSW	6	67292262	missense	probably damaging	1.00
R5696:Il12rb2	UTSW	6	67295278	missense	possibly damaging	0.94
R5704:Il12rb2	UTSW	6	67292213	missense	possibly damaging	0.53
R5891:Il12rb2	UTSW	6	67360690	missense	probably damaging	0.97
R6482:Il12rb2	UTSW	6	67356686	missense	probably damaging	1.00
R6749:Il12rb2	UTSW	6	67361966	start gained	probably benign
R6813:Il12rb2	UTSW	6	67292374	missense	probably damaging	0.98
R6957:Il12rb2	UTSW	6	67292652	missense	possibly damaging	0.60
R7312:Il12rb2	UTSW	6	67356633	missense	probably benign	0.29
R7361:Il12rb2	UTSW	6	67303466	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- ACTGAGATTCCCATGCTGCTC -3'
(R):5'- TCCCAAGCAAGGCTGTTCAC -3'

Sequencing Primer
(F):5'- ACAAAGAAATCTGTCTGGTGTTTGG -3'
(R):5'- GCAAGGCTGTTCACATTATCCCAG -3'

Posted On

2014-12-29