Mutagenetix > Incidental Mutation

Incidental Mutation 'R2920:Rint1'

255458

Institutional Source

Beutler Lab

Gene Symbol

Rint1

Ensembl Gene

ENSMUSG00000028999

Gene Name

RAD50 interactor 1

Synonyms

2810450M21Rik, 1500019C06Rik

MMRRC Submission

040505-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23787711-23820369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23805402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 203 (E203G)

Ref Sequence

ENSEMBL: ENSMUSP00000030852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]

AlphaFold

Q8BZ36

Predicted Effect

probably benign
Transcript: ENSMUST00000030852
AA Change: E203G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: E203G

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	304	784	2.3e-135	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115113

SMART Domains

Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	246	727	1.2e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124680

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132260

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Chl1	C	A	6: 103,695,343	T531K	probably damaging	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Crebbp	A	G	16: 4,119,082	V343A	probably damaging	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Il12rb2	C	T	6: 67,360,568	V110I	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo10	G	T	15: 25,801,140	V1472L	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc14a2	G	T	18: 78,158,297	S669*	probably null	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Slc4a5	T	C	6: 83,264,387	L215P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Rint1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rint1	APN	5	23794431	missense	probably benign	0.00
IGL00596:Rint1	APN	5	23811865	missense	probably damaging	0.99
IGL01685:Rint1	APN	5	23787834	unclassified	probably benign
IGL02428:Rint1	APN	5	23794452	nonsense	probably null
IGL03007:Rint1	APN	5	23815701	missense	probably benign	0.00
IGL03280:Rint1	APN	5	23817078	missense	probably damaging	1.00
breakage	UTSW	5	23800722	missense	probably damaging	0.99
IGL02799:Rint1	UTSW	5	23819480	missense	possibly damaging	0.93
R0062:Rint1	UTSW	5	23787828	unclassified	probably benign
R0243:Rint1	UTSW	5	23816932	splice site	probably benign
R1102:Rint1	UTSW	5	23805567	splice site	probably benign
R1552:Rint1	UTSW	5	23800658	missense	probably benign	0.00
R1729:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R1784:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R2070:Rint1	UTSW	5	23810929	missense	possibly damaging	0.94
R3114:Rint1	UTSW	5	23819420	missense	probably benign	0.27
R4398:Rint1	UTSW	5	23794447	missense	possibly damaging	0.55
R4756:Rint1	UTSW	5	23809793	missense	probably damaging	1.00
R5246:Rint1	UTSW	5	23800811	missense	probably damaging	0.99
R5452:Rint1	UTSW	5	23794365	missense	probably benign	0.01
R5566:Rint1	UTSW	5	23810953	missense	probably damaging	1.00
R5709:Rint1	UTSW	5	23815833	missense	probably damaging	0.98
R6524:Rint1	UTSW	5	23815739	missense	probably benign	0.00
R7346:Rint1	UTSW	5	23815653	missense	possibly damaging	0.82
R7549:Rint1	UTSW	5	23815704	missense	probably benign
R7634:Rint1	UTSW	5	23805479	missense	probably benign	0.00
R7647:Rint1	UTSW	5	23800802	missense	probably damaging	1.00
R7885:Rint1	UTSW	5	23805644	missense	probably benign
R7895:Rint1	UTSW	5	23800722	missense	probably damaging	0.99
R8347:Rint1	UTSW	5	23811772	missense	probably damaging	1.00
R8791:Rint1	UTSW	5	23800596	missense	probably damaging	0.99
R8900:Rint1	UTSW	5	23811884	missense	possibly damaging	0.77
R8916:Rint1	UTSW	5	23787828	unclassified	probably benign
R8973:Rint1	UTSW	5	23811730	missense	probably benign	0.00
R9245:Rint1	UTSW	5	23805413	missense	probably benign
R9339:Rint1	UTSW	5	23788357	makesense	probably null
R9630:Rint1	UTSW	5	23815812	missense	possibly damaging	0.82
R9718:Rint1	UTSW	5	23800723	missense	possibly damaging	0.53
Z1088:Rint1	UTSW	5	23805314	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCATTGTCCTCAGGGTAC -3'
(R):5'- AGCTGTGCCAAGACTTCCTC -3'

Sequencing Primer
(F):5'- TTGTCCTCAGGGTACACACAC -3'
(R):5'- GCTGTGCCAAGACTTCCTCAAAATC -3'

Posted On

2014-12-29