Incidental Mutation 'R2920:Rint1'
ID255458
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene NameRAD50 interactor 1
Synonyms2810450M21Rik, 1500019C06Rik
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2920 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23787711-23820369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23805402 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 203 (E203G)
Ref Sequence ENSEMBL: ENSMUSP00000030852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
Predicted Effect probably benign
Transcript: ENSMUST00000030852
AA Change: E203G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: E203G

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115113
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132260
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23794431 missense probably benign 0.00
IGL00596:Rint1 APN 5 23811865 missense probably damaging 0.99
IGL01685:Rint1 APN 5 23787834 unclassified probably benign
IGL02428:Rint1 APN 5 23794452 nonsense probably null
IGL03007:Rint1 APN 5 23815701 missense probably benign 0.00
IGL03280:Rint1 APN 5 23817078 missense probably damaging 1.00
breakage UTSW 5 23800722 missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 23819480 missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23787828 unclassified probably benign
R0243:Rint1 UTSW 5 23816932 splice site probably benign
R1102:Rint1 UTSW 5 23805567 splice site probably benign
R1552:Rint1 UTSW 5 23800658 missense probably benign 0.00
R1729:Rint1 UTSW 5 23809843 missense probably benign 0.00
R1784:Rint1 UTSW 5 23809843 missense probably benign 0.00
R2070:Rint1 UTSW 5 23810929 missense possibly damaging 0.94
R3114:Rint1 UTSW 5 23819420 missense probably benign 0.27
R4398:Rint1 UTSW 5 23794447 missense possibly damaging 0.55
R4756:Rint1 UTSW 5 23809793 missense probably damaging 1.00
R5246:Rint1 UTSW 5 23800811 missense probably damaging 0.99
R5452:Rint1 UTSW 5 23794365 missense probably benign 0.01
R5566:Rint1 UTSW 5 23810953 missense probably damaging 1.00
R5709:Rint1 UTSW 5 23815833 missense probably damaging 0.98
R6524:Rint1 UTSW 5 23815739 missense probably benign 0.00
R7346:Rint1 UTSW 5 23815653 missense possibly damaging 0.82
R7549:Rint1 UTSW 5 23815704 missense probably benign
R7634:Rint1 UTSW 5 23805479 missense probably benign 0.00
R7647:Rint1 UTSW 5 23800802 missense probably damaging 1.00
R7885:Rint1 UTSW 5 23805644 missense probably benign
R7895:Rint1 UTSW 5 23800722 missense probably damaging 0.99
R8347:Rint1 UTSW 5 23811772 missense probably damaging 1.00
R8791:Rint1 UTSW 5 23800596 missense probably damaging 0.99
R8900:Rint1 UTSW 5 23811884 missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23787828 unclassified probably benign
Z1088:Rint1 UTSW 5 23805314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCATTGTCCTCAGGGTAC -3'
(R):5'- AGCTGTGCCAAGACTTCCTC -3'

Sequencing Primer
(F):5'- TTGTCCTCAGGGTACACACAC -3'
(R):5'- GCTGTGCCAAGACTTCCTCAAAATC -3'
Posted On2014-12-29