Incidental Mutation 'R2920:Myo9b'
ID 255475
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71272714-71360713 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71325857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 445 (K445R)
Ref Sequence ENSEMBL: ENSMUSP00000131635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: K445R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: K445R

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168839
AA Change: K445R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: K445R

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: K445R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: K445R

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212935
AA Change: K445R

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1482 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0689:Myo9b UTSW 8 71330756 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2037:Myo9b UTSW 8 71290866 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R4736:Myo9b UTSW 8 71356592 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
R7957:Myo9b UTSW 8 71354761 missense probably benign 0.12
R8062:Myo9b UTSW 8 71321813 missense probably damaging 0.99
R8108:Myo9b UTSW 8 71348342 missense probably damaging 0.99
R8197:Myo9b UTSW 8 71290963 missense probably damaging 1.00
R8274:Myo9b UTSW 8 71359836 missense probably benign 0.00
R8686:Myo9b UTSW 8 71334322 missense probably benign 0.01
R8731:Myo9b UTSW 8 71353842 critical splice donor site probably null
R8924:Myo9b UTSW 8 71349031 missense probably benign
R9056:Myo9b UTSW 8 71352262 missense probably benign 0.17
R9117:Myo9b UTSW 8 71347807 missense probably benign 0.03
R9315:Myo9b UTSW 8 71349167 missense possibly damaging 0.54
R9332:Myo9b UTSW 8 71359602 missense probably benign 0.07
R9364:Myo9b UTSW 8 71355839 missense probably damaging 1.00
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71290709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCCAGGCAGATGAATC -3'
(R):5'- TGACTGCCTCTGCTTTGTGG -3'

Sequencing Primer
(F):5'- GGTGTTGAACTTACAGAGATCCACC -3'
(R):5'- GCTTGGTAGGAGCTGAGCATG -3'
Posted On 2014-12-29