Mutagenetix > Incidental Mutation

Incidental Mutation 'R2920:Slc4a5'

255466

Institutional Source

Beutler Lab

Gene Symbol

Slc4a5

Ensembl Gene

ENSMUSG00000068323

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 5

Synonyms

C330016K18Rik

MMRRC Submission

040505-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R2920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83219828-83304945 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83264387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 215 (L215P)

Ref Sequence

ENSEMBL: ENSMUSP00000109532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]

AlphaFold

E9Q3M5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039212
AA Change: L215P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: L215P

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	5.2e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	1.1e-242	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113899
AA Change: L215P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: L215P

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	25	292	2.9e-102	PFAM
low complexity region	321	350	N/A	INTRINSIC
Pfam:HCO3_cotransp	364	884	5.3e-243	PFAM
transmembrane domain	891	913	N/A	INTRINSIC
low complexity region	936	951	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113900
AA Change: L330P

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: L330P

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	140	407	3.4e-106	PFAM
low complexity region	436	465	N/A	INTRINSIC
Pfam:HCO3_cotransp	480	999	1.6e-224	PFAM
transmembrane domain	1006	1028	N/A	INTRINSIC
low complexity region	1051	1066	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122897

Meta Mutation Damage Score

0.9523

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Chl1	C	A	6: 103,695,343	T531K	probably damaging	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Crebbp	A	G	16: 4,119,082	V343A	probably damaging	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Il12rb2	C	T	6: 67,360,568	V110I	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo10	G	T	15: 25,801,140	V1472L	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rint1	A	G	5: 23,805,402	E203G	probably benign	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc14a2	G	T	18: 78,158,297	S669*	probably null	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Slc4a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Slc4a5	APN	6	83285899	missense	probably damaging	1.00
IGL00473:Slc4a5	APN	6	83296597	missense	probably damaging	1.00
IGL00861:Slc4a5	APN	6	83299471	missense	probably benign
IGL01025:Slc4a5	APN	6	83262533	missense	probably damaging	0.98
IGL01532:Slc4a5	APN	6	83273040	splice site	probably null
IGL01991:Slc4a5	APN	6	83263543	missense	possibly damaging	0.94
IGL02271:Slc4a5	APN	6	83271103	splice site	probably benign
IGL02565:Slc4a5	APN	6	83299505	missense	probably benign	0.00
IGL02669:Slc4a5	APN	6	83263543	missense	possibly damaging	0.79
IGL02994:Slc4a5	APN	6	83272124	missense	probably damaging	1.00
IGL03259:Slc4a5	APN	6	83270997	missense	probably damaging	1.00
IGL03264:Slc4a5	APN	6	83261525	missense	probably damaging	1.00
R0032:Slc4a5	UTSW	6	83273157	missense	probably damaging	1.00
R0091:Slc4a5	UTSW	6	83277555	missense	probably benign	0.00
R0281:Slc4a5	UTSW	6	83267567	splice site	probably benign
R0366:Slc4a5	UTSW	6	83295872	missense	probably benign	0.02
R0668:Slc4a5	UTSW	6	83271072	missense	probably damaging	1.00
R1222:Slc4a5	UTSW	6	83280132	missense	probably damaging	1.00
R1550:Slc4a5	UTSW	6	83271057	missense	probably damaging	1.00
R1585:Slc4a5	UTSW	6	83265687	missense	probably damaging	1.00
R1731:Slc4a5	UTSW	6	83296635	missense	probably damaging	1.00
R1987:Slc4a5	UTSW	6	83273232	missense	possibly damaging	0.95
R2103:Slc4a5	UTSW	6	83224681	missense	probably benign	0.00
R2103:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2104:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2176:Slc4a5	UTSW	6	83262560	missense	probably damaging	0.98
R2964:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2965:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2966:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R3755:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R3756:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R4293:Slc4a5	UTSW	6	83260529	missense	probably damaging	1.00
R4789:Slc4a5	UTSW	6	83270969	missense	probably benign	0.05
R4823:Slc4a5	UTSW	6	83272133	missense	probably damaging	1.00
R4854:Slc4a5	UTSW	6	83271017	missense	probably benign	0.00
R5461:Slc4a5	UTSW	6	83285854	missense	probably benign	0.29
R5707:Slc4a5	UTSW	6	83261415	missense	probably benign	0.11
R5747:Slc4a5	UTSW	6	83271029	missense	probably damaging	1.00
R5978:Slc4a5	UTSW	6	83277536	missense	probably benign	0.01
R6126:Slc4a5	UTSW	6	83226265	missense	probably benign	0.05
R6330:Slc4a5	UTSW	6	83226374	missense	probably benign
R6564:Slc4a5	UTSW	6	83280060	missense	possibly damaging	0.71
R6786:Slc4a5	UTSW	6	83296747	critical splice donor site	probably null
R7443:Slc4a5	UTSW	6	83264315	missense	probably benign	0.45
R7672:Slc4a5	UTSW	6	83260535	missense	probably damaging	1.00
R7690:Slc4a5	UTSW	6	83285872	missense	probably damaging	1.00
R7837:Slc4a5	UTSW	6	83261557	missense	probably benign	0.01
R8169:Slc4a5	UTSW	6	83303391	missense	probably benign	0.12
R8288:Slc4a5	UTSW	6	83226255	missense	probably benign	0.01
R8397:Slc4a5	UTSW	6	83289326	critical splice donor site	probably null
R8849:Slc4a5	UTSW	6	83273198	missense	probably damaging	1.00
R9033:Slc4a5	UTSW	6	83260475	nonsense	probably null
R9133:Slc4a5	UTSW	6	83226235	missense	possibly damaging	0.85
R9201:Slc4a5	UTSW	6	83285830	missense	probably benign	0.02
R9269:Slc4a5	UTSW	6	83289241	missense	possibly damaging	0.88
R9603:Slc4a5	UTSW	6	83240732	missense	probably benign	0.34
R9781:Slc4a5	UTSW	6	83262484	missense	probably benign	0.00
Z1177:Slc4a5	UTSW	6	83280033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATGCCAGGTCTTCTTGG -3'
(R):5'- GAGCATCCTTACATTTGCATTGC -3'

Sequencing Primer
(F):5'- GGTGTGTCATTTTCCTCCCGG -3'
(R):5'- GGCATCCTTCAAGACAGGGTTTC -3'

Posted On

2014-12-29