Incidental Mutation 'R4413:Vmn2r99'
ID 328035
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission 041136-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R4413 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19361949-19401098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19379260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 402 (V402E)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably damaging
Transcript: ENSMUST00000176107
AA Change: V402E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: V402E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231989
AA Change: V402E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Exoc1 A G 5: 76,542,019 probably benign Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Mrm1 G T 11: 84,819,228 R49S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syn3 C A 10: 86,055,592 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19393817 missense possibly damaging 0.91
R8039:Vmn2r99 UTSW 17 19380040 missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19393758 missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19394181 missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19393660 critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19378126 nonsense probably null
R9681:Vmn2r99 UTSW 17 19378627 missense probably damaging 1.00
R9737:Vmn2r99 UTSW 17 19362301 missense probably benign
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GTCTGGATCATGAACATTGAACATC -3'
(R):5'- TGCTCCTGGTATCTTGTACATG -3'

Sequencing Primer
(F):5'- CCATGGAAGCCTAATTTTTAAGCAC -3'
(R):5'- GCTCCTGGTATCTTGTACATGATTTC -3'
Posted On 2015-07-07