Incidental Mutation 'R4828:Flnb'
ID372613
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 042444-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7919238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1664 (V1664I)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: V1664I

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V1664I

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Adat3 T C 10: 80,607,047 S240P probably benign Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dip2c T A 13: 9,560,679 W356R probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dnah7b T A 1: 46,128,112 V588D possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Ppp1r42 C T 1: 9,999,411 R142H probably benign Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Selenbp2 A G 3: 94,704,119 N379S probably benign Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCTGCCTGGCAAACATAGACAG -3'
(R):5'- AACAAATGACGGTTGTGACTGC -3'

Sequencing Primer
(F):5'- GCACAACATAGTATGGCCTGTTCTG -3'
(R):5'- GACTGCTTCTGCTAGTAAGAGCC -3'
Posted On2016-03-01