Mutagenetix > Incidental Mutation

Incidental Mutation 'R0426:Kank1'

38701

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

038628-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25411473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 809 (V809I)

Ref Sequence

ENSEMBL: ENSMUSP00000042177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

AlphaFold

E9Q238

Predicted Effect

probably damaging
Transcript: ENSMUST00000049400
AA Change: V809I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V809I

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137260

Predicted Effect

probably benign
Transcript: ENSMUST00000146647
AA Change: V837I

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V837I

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Meta Mutation Damage Score

0.0822

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (86/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	C	T	5: 107,510,373	T1603I	probably damaging	Het
Abca8b	G	T	11: 109,955,027		probably benign	Het
Acadl	A	T	1: 66,841,646	F320L	probably damaging	Het
Acsbg1	T	C	9: 54,622,746	D222G	probably benign	Het
Anapc15	A	G	7: 101,898,033	T39A	probably benign	Het
Ano3	A	T	2: 110,661,174	V919E	probably damaging	Het
Arhgef12	T	C	9: 42,970,990		probably null	Het
Atad5	T	A	11: 80,112,832	I1091N	probably benign	Het
Atf1	A	T	15: 100,232,827	H26L	possibly damaging	Het
Atp10a	T	C	7: 58,784,734	M252T	probably benign	Het
Cd55	C	T	1: 130,448,372	R347H	probably benign	Het
Cdc27	A	C	11: 104,513,027		probably null	Het
Cdh9	G	A	15: 16,823,454		probably null	Het
Cdk11b	T	C	4: 155,642,512		probably benign	Het
Cep70	A	G	9: 99,297,684	D567G	probably benign	Het
Cep78	A	T	19: 15,970,970	Y382*	probably null	Het
Col9a2	T	C	4: 121,044,660		probably benign	Het
Cyp2d12	G	A	15: 82,558,963	D409N	probably benign	Het
Ddx39	A	G	8: 83,721,769	T217A	probably benign	Het
Dennd1b	T	A	1: 139,170,196	D733E	probably benign	Het
Dicer1	A	G	12: 104,702,542	S1294P	probably damaging	Het
Dnah3	T	C	7: 119,943,572	E3539G	probably benign	Het
Dnmbp	A	G	19: 43,852,436		probably benign	Het
Dysf	T	C	6: 84,149,757	L1332P	probably damaging	Het
F5	A	G	1: 164,182,840	D380G	probably damaging	Het
Fam160a2	A	C	7: 105,389,473	C186W	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Galr2	C	A	11: 116,281,691	A69D	probably damaging	Het
Grk2	T	C	19: 4,290,600		probably null	Het
Gtf3c1	A	T	7: 125,663,016	Y1119*	probably null	Het
Hgd	A	T	16: 37,588,685		probably benign	Het
Ildr2	G	T	1: 166,308,899	V436L	probably benign	Het
Intu	G	A	3: 40,675,305	C355Y	probably damaging	Het
Irf2bpl	G	T	12: 86,883,096	P268T	probably benign	Het
Jarid2	T	C	13: 44,840,882		probably null	Het
Jup	A	T	11: 100,372,401	M716K	probably benign	Het
Kdm1b	T	A	13: 47,064,244		probably benign	Het
Kdm3a	C	T	6: 71,600,755	C687Y	probably damaging	Het
Kdm5d	T	A	Y: 942,437		probably benign	Het
Kifap3	T	A	1: 163,865,552		probably benign	Het
Macf1	T	A	4: 123,483,660	K1400*	probably null	Het
Majin	A	G	19: 6,212,117		probably benign	Het
Mb21d1	G	A	9: 78,435,738		probably benign	Het
Mctp1	A	G	13: 77,020,821	I846V	probably benign	Het
Mrgpra2b	T	A	7: 47,464,127	I286F	possibly damaging	Het
Neil3	T	G	8: 53,609,396		probably benign	Het
Nox3	G	T	17: 3,695,563	N23K	probably damaging	Het
Nt5c3	T	C	6: 56,883,812	K219E	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr213	A	T	6: 116,540,485	N11Y	probably damaging	Het
Olfr389	T	A	11: 73,776,437	M297L	probably benign	Het
Olfr524	A	C	7: 140,202,116	F218C	possibly damaging	Het
Olfr548-ps1	T	A	7: 102,542,686	I250N	probably damaging	Het
Olfr954	T	C	9: 39,461,593	L54P	probably damaging	Het
Pacsin2	A	G	15: 83,379,795	V347A	possibly damaging	Het
Pcdhb7	A	T	18: 37,342,804	E331V	probably damaging	Het
Pcid2	A	C	8: 13,081,262		probably null	Het
Pcsk9	T	C	4: 106,450,077	D323G	possibly damaging	Het
Pdhb	T	C	14: 8,169,801	E203G	probably damaging	Het
Phlpp2	A	G	8: 109,928,463	Y630C	probably benign	Het
Pidd1	C	T	7: 141,439,133	A812T	probably damaging	Het
Plau	G	A	14: 20,842,314	R389H	probably benign	Het
Plekhg6	G	A	6: 125,364,629		probably null	Het
Ppox	T	C	1: 171,277,749	Y321C	probably damaging	Het
Pxdn	A	G	12: 29,987,066	N281S	possibly damaging	Het
Pycrl	A	T	15: 75,918,388	M138K	probably benign	Het
Radil	T	C	5: 142,497,873	Y526C	probably damaging	Het
Ranbp3	C	A	17: 56,707,169	D233E	probably benign	Het
Rhpn1	A	G	15: 75,711,872	Q402R	possibly damaging	Het
Sec23b	T	A	2: 144,568,612		probably benign	Het
Sel1l2	A	T	2: 140,240,912	L602*	probably null	Het
Sema5b	G	A	16: 35,646,355	G209D	probably damaging	Het
Svep1	T	C	4: 58,073,333	Y1992C	possibly damaging	Het
Syncrip	T	A	9: 88,456,259		probably benign	Het
Synj1	G	T	16: 90,967,354	A65E	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tecrl	T	C	5: 83,354,763		probably benign	Het
Tenm4	G	T	7: 96,777,851	G698C	probably damaging	Het
Tmem209	G	A	6: 30,491,182	L259F	probably damaging	Het
Tmem247	G	A	17: 86,918,503	E124K	possibly damaging	Het
Tnks2	C	A	19: 36,852,821	A218E	probably damaging	Het
Tppp	T	A	13: 74,021,311	F57I	probably damaging	Het
Trim36	A	G	18: 46,172,525	W452R	probably damaging	Het
Vars2	A	T	17: 35,664,584	V262E	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zfp516	G	T	18: 82,955,772	A32S	probably benign	Het
Zfy2	G	T	Y: 2,107,348	L429I	possibly damaging	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97
R8705:Kank1	UTSW	19	25411543	missense	probably damaging	1.00
R8855:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8866:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8891:Kank1	UTSW	19	25410075	missense	probably benign	0.32
R8894:Kank1	UTSW	19	25431014	missense	probably damaging	1.00
R8917:Kank1	UTSW	19	25409564	missense	probably damaging	0.99
R9217:Kank1	UTSW	19	25409580	missense	possibly damaging	0.92
R9301:Kank1	UTSW	19	25411434	missense	probably benign	0.00
R9431:Kank1	UTSW	19	25410502	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCTGTGAAGACCAAAGAGTCG -3'
(R):5'- AGAGCCTTGAGCTACGCAAATCC -3'

Sequencing Primer
(F):5'- CCAAAGAGTCGGGTGTGG -3'
(R):5'- GCTTGCAGACTTCATGACG -3'

Posted On

2013-05-23