Mutagenetix > Incidental Mutation

Incidental Mutation 'R0426:Tenm4'

38646

Institutional Source

Beutler Lab

Gene Symbol

Tenm4

Ensembl Gene

ENSMUSG00000048078

Gene Name

teneurin transmembrane protein 4

Synonyms

Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4

MMRRC Submission

038628-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0426 (G1)

Quality Score

108

Status

Not validated

Chromosome

Chromosomal Location

96171246-96911093 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 96777851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 698 (G698C)

Ref Sequence

ENSEMBL: ENSMUSP00000102784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107162
AA Change: G743C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: G743C

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	410	5.6e-195	PFAM
transmembrane domain	411	433	N/A	INTRINSIC
EGF_like	637	665	3.43e1	SMART
EGF	668	696	2.29e1	SMART
EGF	701	730	1.88e-1	SMART
EGF	733	762	1.13e1	SMART
EGF	767	797	2.39e1	SMART
EGF	800	828	4.32e-1	SMART
EGF	831	859	6.02e0	SMART
EGF	862	894	9.93e-1	SMART
low complexity region	900	914	N/A	INTRINSIC
Pfam:RHS_repeat	2327	2380	5.5e-7	PFAM
Pfam:Tox-GHH	2740	2818	5.2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107165
AA Change: G735C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: G735C

Domain	Start	End	E-Value	Type
Pfam:Ten_N	36	402	1.1e-171	PFAM
transmembrane domain	403	425	N/A	INTRINSIC
EGF_like	629	657	3.43e1	SMART
EGF	660	688	2.29e1	SMART
EGF	693	722	1.88e-1	SMART
EGF	725	754	1.13e1	SMART
EGF	759	789	2.39e1	SMART
EGF	792	820	4.32e-1	SMART
EGF	823	851	6.02e0	SMART
EGF	863	895	9.93e-1	SMART
low complexity region	901	915	N/A	INTRINSIC
Pfam:RHS_repeat	2335	2368	1.6e-7	PFAM
Pfam:Tox-GHH	2749	2826	1.8e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107166
AA Change: G698C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: G698C

Domain	Start	End	E-Value	Type
Pfam:Ten_N	35	193	1.4e-83	PFAM
Pfam:Ten_N	187	365	5e-78	PFAM
transmembrane domain	366	388	N/A	INTRINSIC
EGF_like	592	620	3.43e1	SMART
EGF	623	651	2.29e1	SMART
EGF	656	685	1.88e-1	SMART
EGF	688	717	1.13e1	SMART
EGF	722	752	2.39e1	SMART
EGF	755	783	4.32e-1	SMART
EGF	786	814	6.02e0	SMART
EGF	826	858	9.93e-1	SMART
low complexity region	864	878	N/A	INTRINSIC
Pfam:RHS_repeat	2298	2351	3.8e-7	PFAM
Pfam:Tox-GHH	2711	2789	3.9e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140140

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (86/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	C	T	5: 107,510,373	T1603I	probably damaging	Het
Abca8b	G	T	11: 109,955,027		probably benign	Het
Acadl	A	T	1: 66,841,646	F320L	probably damaging	Het
Acsbg1	T	C	9: 54,622,746	D222G	probably benign	Het
Anapc15	A	G	7: 101,898,033	T39A	probably benign	Het
Ano3	A	T	2: 110,661,174	V919E	probably damaging	Het
Arhgef12	T	C	9: 42,970,990		probably null	Het
Atad5	T	A	11: 80,112,832	I1091N	probably benign	Het
Atf1	A	T	15: 100,232,827	H26L	possibly damaging	Het
Atp10a	T	C	7: 58,784,734	M252T	probably benign	Het
Cd55	C	T	1: 130,448,372	R347H	probably benign	Het
Cdc27	A	C	11: 104,513,027		probably null	Het
Cdh9	G	A	15: 16,823,454		probably null	Het
Cdk11b	T	C	4: 155,642,512		probably benign	Het
Cep70	A	G	9: 99,297,684	D567G	probably benign	Het
Cep78	A	T	19: 15,970,970	Y382*	probably null	Het
Col9a2	T	C	4: 121,044,660		probably benign	Het
Cyp2d12	G	A	15: 82,558,963	D409N	probably benign	Het
Ddx39	A	G	8: 83,721,769	T217A	probably benign	Het
Dennd1b	T	A	1: 139,170,196	D733E	probably benign	Het
Dicer1	A	G	12: 104,702,542	S1294P	probably damaging	Het
Dnah3	T	C	7: 119,943,572	E3539G	probably benign	Het
Dnmbp	A	G	19: 43,852,436		probably benign	Het
Dysf	T	C	6: 84,149,757	L1332P	probably damaging	Het
F5	A	G	1: 164,182,840	D380G	probably damaging	Het
Fam160a2	A	C	7: 105,389,473	C186W	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Galr2	C	A	11: 116,281,691	A69D	probably damaging	Het
Grk2	T	C	19: 4,290,600		probably null	Het
Gtf3c1	A	T	7: 125,663,016	Y1119*	probably null	Het
Hgd	A	T	16: 37,588,685		probably benign	Het
Ildr2	G	T	1: 166,308,899	V436L	probably benign	Het
Intu	G	A	3: 40,675,305	C355Y	probably damaging	Het
Irf2bpl	G	T	12: 86,883,096	P268T	probably benign	Het
Jarid2	T	C	13: 44,840,882		probably null	Het
Jup	A	T	11: 100,372,401	M716K	probably benign	Het
Kank1	G	A	19: 25,411,473	V809I	probably damaging	Het
Kdm1b	T	A	13: 47,064,244		probably benign	Het
Kdm3a	C	T	6: 71,600,755	C687Y	probably damaging	Het
Kdm5d	T	A	Y: 942,437		probably benign	Het
Kifap3	T	A	1: 163,865,552		probably benign	Het
Macf1	T	A	4: 123,483,660	K1400*	probably null	Het
Majin	A	G	19: 6,212,117		probably benign	Het
Mb21d1	G	A	9: 78,435,738		probably benign	Het
Mctp1	A	G	13: 77,020,821	I846V	probably benign	Het
Mrgpra2b	T	A	7: 47,464,127	I286F	possibly damaging	Het
Neil3	T	G	8: 53,609,396		probably benign	Het
Nox3	G	T	17: 3,695,563	N23K	probably damaging	Het
Nt5c3	T	C	6: 56,883,812	K219E	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr213	A	T	6: 116,540,485	N11Y	probably damaging	Het
Olfr389	T	A	11: 73,776,437	M297L	probably benign	Het
Olfr524	A	C	7: 140,202,116	F218C	possibly damaging	Het
Olfr548-ps1	T	A	7: 102,542,686	I250N	probably damaging	Het
Olfr954	T	C	9: 39,461,593	L54P	probably damaging	Het
Pacsin2	A	G	15: 83,379,795	V347A	possibly damaging	Het
Pcdhb7	A	T	18: 37,342,804	E331V	probably damaging	Het
Pcid2	A	C	8: 13,081,262		probably null	Het
Pcsk9	T	C	4: 106,450,077	D323G	possibly damaging	Het
Pdhb	T	C	14: 8,169,801	E203G	probably damaging	Het
Phlpp2	A	G	8: 109,928,463	Y630C	probably benign	Het
Pidd1	C	T	7: 141,439,133	A812T	probably damaging	Het
Plau	G	A	14: 20,842,314	R389H	probably benign	Het
Plekhg6	G	A	6: 125,364,629		probably null	Het
Ppox	T	C	1: 171,277,749	Y321C	probably damaging	Het
Pxdn	A	G	12: 29,987,066	N281S	possibly damaging	Het
Pycrl	A	T	15: 75,918,388	M138K	probably benign	Het
Radil	T	C	5: 142,497,873	Y526C	probably damaging	Het
Ranbp3	C	A	17: 56,707,169	D233E	probably benign	Het
Rhpn1	A	G	15: 75,711,872	Q402R	possibly damaging	Het
Sec23b	T	A	2: 144,568,612		probably benign	Het
Sel1l2	A	T	2: 140,240,912	L602*	probably null	Het
Sema5b	G	A	16: 35,646,355	G209D	probably damaging	Het
Svep1	T	C	4: 58,073,333	Y1992C	possibly damaging	Het
Syncrip	T	A	9: 88,456,259		probably benign	Het
Synj1	G	T	16: 90,967,354	A65E	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tecrl	T	C	5: 83,354,763		probably benign	Het
Tmem209	G	A	6: 30,491,182	L259F	probably damaging	Het
Tmem247	G	A	17: 86,918,503	E124K	possibly damaging	Het
Tnks2	C	A	19: 36,852,821	A218E	probably damaging	Het
Tppp	T	A	13: 74,021,311	F57I	probably damaging	Het
Trim36	A	G	18: 46,172,525	W452R	probably damaging	Het
Vars2	A	T	17: 35,664,584	V262E	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zfp516	G	T	18: 82,955,772	A32S	probably benign	Het
Zfy2	G	T	Y: 2,107,348	L429I	possibly damaging	Het

Other mutations in Tenm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Tenm4	APN	7	96868009	missense	probably benign	0.00
IGL00468:Tenm4	APN	7	96874472	missense	probably damaging	0.98
IGL00519:Tenm4	APN	7	96805138	splice site	probably benign
IGL00979:Tenm4	APN	7	96729391	missense	probably damaging	0.96
IGL01401:Tenm4	APN	7	96874267	missense	probably damaging	1.00
IGL01459:Tenm4	APN	7	96729385	missense	probably damaging	1.00
IGL01519:Tenm4	APN	7	96895177	missense	probably damaging	1.00
IGL01545:Tenm4	APN	7	96874303	missense	probably benign	0.00
IGL01579:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01587:Tenm4	APN	7	96863502	missense	probably benign	0.00
IGL01625:Tenm4	APN	7	96885358	missense	probably damaging	1.00
IGL01655:Tenm4	APN	7	96553724	missense	probably damaging	1.00
IGL01683:Tenm4	APN	7	96885404	missense	possibly damaging	0.84
IGL01728:Tenm4	APN	7	96896064	missense	probably damaging	1.00
IGL01732:Tenm4	APN	7	96895509	missense	probably damaging	1.00
IGL01924:Tenm4	APN	7	96895212	missense	probably damaging	1.00
IGL01966:Tenm4	APN	7	96553550	missense	probably damaging	1.00
IGL02177:Tenm4	APN	7	96895662	missense	probably benign	0.40
IGL02207:Tenm4	APN	7	96874116	missense	possibly damaging	0.85
IGL02269:Tenm4	APN	7	96823822	missense	probably damaging	1.00
IGL02274:Tenm4	APN	7	96854734	missense	probably damaging	1.00
IGL02375:Tenm4	APN	7	96704137	missense	possibly damaging	0.52
IGL02415:Tenm4	APN	7	96874074	missense	probably damaging	0.98
IGL02472:Tenm4	APN	7	96774176	unclassified	probably benign
IGL02656:Tenm4	APN	7	96885433	missense	probably damaging	1.00
IGL02678:Tenm4	APN	7	96896219	missense	probably damaging	1.00
IGL02829:Tenm4	APN	7	96894998	nonsense	probably null
IGL02863:Tenm4	APN	7	96873706	missense	probably damaging	1.00
IGL03145:Tenm4	APN	7	96842968	missense	probably damaging	0.98
IGL03153:Tenm4	APN	7	96873762	missense	probably damaging	1.00
principium	UTSW	7	96797481	missense	probably damaging	0.98
toccata	UTSW	7	96902989	critical splice donor site	probably null
P0026:Tenm4	UTSW	7	96874527	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0097:Tenm4	UTSW	7	96892926	missense	probably damaging	1.00
R0140:Tenm4	UTSW	7	96896052	missense	possibly damaging	0.78
R0164:Tenm4	UTSW	7	96729340	splice site	probably benign
R0277:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0323:Tenm4	UTSW	7	96694950	missense	possibly damaging	0.54
R0362:Tenm4	UTSW	7	96772035	nonsense	probably null
R0381:Tenm4	UTSW	7	96905881	missense	probably damaging	1.00
R0420:Tenm4	UTSW	7	96873766	missense	possibly damaging	0.85
R0513:Tenm4	UTSW	7	96895623	missense	probably benign	0.35
R0624:Tenm4	UTSW	7	96774020	missense	probably damaging	1.00
R0837:Tenm4	UTSW	7	96896275	splice site	probably benign
R1037:Tenm4	UTSW	7	96797481	missense	probably damaging	0.98
R1172:Tenm4	UTSW	7	96848044	missense	probably damaging	1.00
R1422:Tenm4	UTSW	7	96550051	missense	probably damaging	0.99
R1427:Tenm4	UTSW	7	96843048	missense	probably benign	0.42
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1462:Tenm4	UTSW	7	96704153	missense	probably damaging	1.00
R1597:Tenm4	UTSW	7	96902989	critical splice donor site	probably null
R1701:Tenm4	UTSW	7	96902889	missense	probably damaging	1.00
R1707:Tenm4	UTSW	7	96888685	missense	probably damaging	1.00
R1809:Tenm4	UTSW	7	96873780	missense	probably benign	0.17
R1812:Tenm4	UTSW	7	96895940	missense	probably damaging	1.00
R1895:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R1933:Tenm4	UTSW	7	96895326	missense	probably damaging	1.00
R1946:Tenm4	UTSW	7	96735808	missense	probably damaging	1.00
R2108:Tenm4	UTSW	7	96906290	missense	probably damaging	1.00
R2151:Tenm4	UTSW	7	96902847	missense	probably damaging	1.00
R2247:Tenm4	UTSW	7	96906009	missense	probably benign	0.03
R2329:Tenm4	UTSW	7	96895862	missense	probably benign	0.00
R2893:Tenm4	UTSW	7	96894990	missense	probably damaging	1.00
R2990:Tenm4	UTSW	7	96893125	splice site	probably null
R3409:Tenm4	UTSW	7	96895160	missense	probably damaging	1.00
R3410:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3411:Tenm4	UTSW	7	96852530	missense	probably damaging	0.99
R3440:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3441:Tenm4	UTSW	7	96553516	missense	probably benign	0.00
R3719:Tenm4	UTSW	7	96863563	missense	possibly damaging	0.92
R3772:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R3773:Tenm4	UTSW	7	96694880	missense	probably damaging	1.00
R4093:Tenm4	UTSW	7	96895772	missense	probably damaging	1.00
R4439:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4441:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4510:Tenm4	UTSW	7	96894863	missense	probably benign
R4511:Tenm4	UTSW	7	96894863	missense	probably benign
R4543:Tenm4	UTSW	7	96895815	missense	probably benign	0.01
R4645:Tenm4	UTSW	7	96895742	missense	probably damaging	1.00
R4701:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R4707:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4714:Tenm4	UTSW	7	96894924	missense	probably damaging	1.00
R4742:Tenm4	UTSW	7	96797484	missense	probably damaging	0.99
R4784:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4785:Tenm4	UTSW	7	96774046	missense	probably damaging	0.99
R4801:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4802:Tenm4	UTSW	7	96906245	missense	probably damaging	0.97
R4880:Tenm4	UTSW	7	96905818	splice site	probably null
R5036:Tenm4	UTSW	7	96694790	missense	probably damaging	1.00
R5036:Tenm4	UTSW	7	96852561	missense	probably damaging	1.00
R5050:Tenm4	UTSW	7	96895788	missense	probably damaging	1.00
R5103:Tenm4	UTSW	7	96842957	missense	probably damaging	1.00
R5106:Tenm4	UTSW	7	96843149	missense	probably damaging	0.99
R5118:Tenm4	UTSW	7	96893086	missense	probably damaging	1.00
R5272:Tenm4	UTSW	7	96874203	missense	probably damaging	0.98
R5282:Tenm4	UTSW	7	96837331	missense	possibly damaging	0.90
R5403:Tenm4	UTSW	7	96888827	missense	probably damaging	1.00
R5404:Tenm4	UTSW	7	96894680	missense	probably damaging	1.00
R5567:Tenm4	UTSW	7	96896209	nonsense	probably null
R5590:Tenm4	UTSW	7	96797400	missense	possibly damaging	0.73
R5590:Tenm4	UTSW	7	96797401	missense	possibly damaging	0.93
R5597:Tenm4	UTSW	7	96553517	missense	probably benign	0.00
R5782:Tenm4	UTSW	7	96893039	missense	probably benign	0.00
R5861:Tenm4	UTSW	7	96843217	intron	probably benign
R5890:Tenm4	UTSW	7	96902860	missense	probably damaging	1.00
R5930:Tenm4	UTSW	7	96854719	missense	probably damaging	1.00
R5940:Tenm4	UTSW	7	96845895	missense	probably damaging	1.00
R6012:Tenm4	UTSW	7	96522433	intron	probably benign
R6060:Tenm4	UTSW	7	96873711	missense	probably damaging	1.00
R6104:Tenm4	UTSW	7	96837289	missense	probably damaging	0.97
R6283:Tenm4	UTSW	7	96874494	missense	probably benign	0.33
R6333:Tenm4	UTSW	7	96774124	missense	probably damaging	1.00
R6522:Tenm4	UTSW	7	96843044	missense	possibly damaging	0.88
R6616:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6746:Tenm4	UTSW	7	96892860	missense	probably damaging	1.00
R6751:Tenm4	UTSW	7	96845712	missense	possibly damaging	0.95
R6806:Tenm4	UTSW	7	96811959	missense	possibly damaging	0.95
R6807:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6807:Tenm4	UTSW	7	96895271	missense	probably damaging	1.00
R6809:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6810:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6811:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6853:Tenm4	UTSW	7	96837295	missense	possibly damaging	0.94
R6886:Tenm4	UTSW	7	96797392	missense	possibly damaging	0.85
R6920:Tenm4	UTSW	7	96895550	missense	probably damaging	1.00
R6937:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R6939:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7011:Tenm4	UTSW	7	96896135	nonsense	probably null
R7033:Tenm4	UTSW	7	96895223	nonsense	probably null
R7040:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7083:Tenm4	UTSW	7	96895349	missense	probably damaging	1.00
R7238:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96553496	missense	probably benign	0.01
R7239:Tenm4	UTSW	7	96735813	missense	possibly damaging	0.47
R7337:Tenm4	UTSW	7	96874126	missense	probably benign	0.44
R7400:Tenm4	UTSW	7	96694803	missense	probably damaging	0.97
R7407:Tenm4	UTSW	7	96773987	missense	possibly damaging	0.89
R7449:Tenm4	UTSW	7	96874213	missense	possibly damaging	0.65
R7473:Tenm4	UTSW	7	96774146	missense	probably damaging	1.00
R7477:Tenm4	UTSW	7	96845808	missense	probably damaging	0.99
R7489:Tenm4	UTSW	7	96837314	missense	possibly damaging	0.90
R7498:Tenm4	UTSW	7	96848017	missense	probably damaging	1.00
R7562:Tenm4	UTSW	7	96888814	missense	probably damaging	1.00
R7615:Tenm4	UTSW	7	96845926	missense	probably damaging	1.00
R7624:Tenm4	UTSW	7	96895985	missense	possibly damaging	0.95
R7626:Tenm4	UTSW	7	96893014	missense	probably damaging	1.00
R7690:Tenm4	UTSW	7	96863533	missense	probably benign	0.00
R7692:Tenm4	UTSW	7	96895403	missense	probably damaging	1.00
R7748:Tenm4	UTSW	7	96894702	missense	probably damaging	1.00
R7763:Tenm4	UTSW	7	96895692	missense	probably benign	0.38
R7792:Tenm4	UTSW	7	96774014	missense	possibly damaging	0.54
R7855:Tenm4	UTSW	7	96873874	missense	probably damaging	1.00
R7868:Tenm4	UTSW	7	96906380	missense	possibly damaging	0.79
R7878:Tenm4	UTSW	7	96852357	missense	probably damaging	1.00
R7997:Tenm4	UTSW	7	96874305	missense	probably benign	0.44
R8017:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8019:Tenm4	UTSW	7	96704041	missense	probably damaging	1.00
R8054:Tenm4	UTSW	7	96729346	splice site	probably benign
R8061:Tenm4	UTSW	7	96852456	missense	probably damaging	1.00
R8108:Tenm4	UTSW	7	96854728	missense	probably benign	0.39
R8140:Tenm4	UTSW	7	96895176	missense	probably damaging	1.00
R8214:Tenm4	UTSW	7	96895407	missense	probably damaging	1.00
R8258:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8259:Tenm4	UTSW	7	96867991	missense	probably damaging	1.00
R8364:Tenm4	UTSW	7	96772106	critical splice donor site	probably null
R8542:Tenm4	UTSW	7	96811932	missense	probably damaging	0.99
R8669:Tenm4	UTSW	7	96905941	missense	probably benign
R8670:Tenm4	UTSW	7	96905941	missense	probably benign
R8683:Tenm4	UTSW	7	96902857	missense	probably damaging	0.99
R8691:Tenm4	UTSW	7	96905941	missense	probably benign
R8692:Tenm4	UTSW	7	96905941	missense	probably benign
R8714:Tenm4	UTSW	7	96905941	missense	probably benign
R8716:Tenm4	UTSW	7	96905941	missense	probably benign
R8735:Tenm4	UTSW	7	96905941	missense	probably benign
R8736:Tenm4	UTSW	7	96905941	missense	probably benign
R8737:Tenm4	UTSW	7	96905941	missense	probably benign
R8738:Tenm4	UTSW	7	96873840	missense	probably damaging	1.00
R8738:Tenm4	UTSW	7	96905941	missense	probably benign
R8739:Tenm4	UTSW	7	96905941	missense	probably benign
R8776:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8776-TAIL:Tenm4	UTSW	7	96895032	missense	probably damaging	1.00
R8777:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8777-TAIL:Tenm4	UTSW	7	96896037	missense	probably damaging	1.00
R8817:Tenm4	UTSW	7	96874128	missense	probably benign	0.01
R8851:Tenm4	UTSW	7	96852503	missense	probably damaging	1.00
R8913:Tenm4	UTSW	7	96702745	splice site	probably benign
R8977:Tenm4	UTSW	7	96811970	missense	probably damaging	1.00
R9100:Tenm4	UTSW	7	96845854	missense	probably damaging	1.00
R9136:Tenm4	UTSW	7	96823918	missense	possibly damaging	0.69
R9163:Tenm4	UTSW	7	96823873	missense	probably damaging	1.00
R9188:Tenm4	UTSW	7	96772027	missense	probably damaging	1.00
R9195:Tenm4	UTSW	7	96892919	missense	probably damaging	1.00
R9217:Tenm4	UTSW	7	96885439	missense	probably damaging	1.00
R9344:Tenm4	UTSW	7	96896145	missense	probably damaging	1.00
R9414:Tenm4	UTSW	7	96896160	missense	probably benign
R9466:Tenm4	UTSW	7	96550045	missense	possibly damaging	0.79
R9559:Tenm4	UTSW	7	96823849	missense	probably benign
R9626:Tenm4	UTSW	7	96896138	missense	probably damaging	1.00
R9673:Tenm4	UTSW	7	96867989	missense	probably damaging	1.00
R9676:Tenm4	UTSW	7	96895431	missense	probably damaging	1.00
R9678:Tenm4	UTSW	7	96737412	missense	possibly damaging	0.94
R9775:Tenm4	UTSW	7	96906554	missense	possibly damaging	0.92
R9790:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9791:Tenm4	UTSW	7	96888839	missense	probably damaging	1.00
R9803:Tenm4	UTSW	7	96553478	missense	probably damaging	1.00
X0021:Tenm4	UTSW	7	96873909	nonsense	probably null
X0026:Tenm4	UTSW	7	96868087	missense	probably damaging	0.98
X0066:Tenm4	UTSW	7	96848030	missense	probably damaging	1.00
X0066:Tenm4	UTSW	7	96894794	missense	probably damaging	1.00
Z1176:Tenm4	UTSW	7	96905914	missense	probably benign	0.00
Z1177:Tenm4	UTSW	7	96863585	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCAGTTTACCTCACAAGCCAAAGGG -3'
(R):5'- ATGGAACAGTCGTGTCCAGTCCAG -3'

Sequencing Primer
(F):5'- agccaaagggcagggac -3'
(R):5'- GCTTGGGTCACAGTTGCAAAG -3'

Posted On

2013-05-23