Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Bcam'

390704

Institutional Source

Beutler Lab

Gene Symbol

Bcam

Ensembl Gene

ENSMUSG00000002980

Gene Name

basal cell adhesion molecule

Synonyms

1200005K12Rik, Lu, B-CAM

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19756131-19771016 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 19756860 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000003061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003061]

AlphaFold

Q9R069

Predicted Effect

probably benign
Transcript: ENSMUST00000003061

SMART Domains

Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG	32	137	3.1e-9	SMART
IG_like	174	254	1.89e1	SMART
IGc2	275	337	2.58e-6	SMART
IGc2	369	425	2.16e-8	SMART
IG_like	458	523	7.29e-2	SMART
transmembrane domain	541	563	N/A	INTRINSIC
low complexity region	601	619	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208280

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rims2	A	T	15: 39,517,869		probably null	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Bcam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Bcam	APN	7	19756799	missense	probably benign	0.02
IGL01433:Bcam	APN	7	19760182	missense	possibly damaging	0.75
IGL01712:Bcam	APN	7	19758767	missense	probably damaging	0.99
IGL01943:Bcam	APN	7	19765498	missense	probably damaging	1.00
IGL01946:Bcam	APN	7	19760117	nonsense	probably null
IGL02281:Bcam	APN	7	19758691	missense	probably damaging	1.00
IGL02714:Bcam	APN	7	19758807	splice site	probably benign
IGL02837:Bcam	UTSW	7	19764186	missense	probably damaging	1.00
PIT4514001:Bcam	UTSW	7	19764066	missense	probably benign	0.06
R0063:Bcam	UTSW	7	19766848	missense	probably benign	0.21
R0063:Bcam	UTSW	7	19766848	missense	probably benign	0.21
R1500:Bcam	UTSW	7	19758964	missense	possibly damaging	0.75
R1575:Bcam	UTSW	7	19760382	missense	possibly damaging	0.87
R1585:Bcam	UTSW	7	19760186	missense	probably damaging	1.00
R1768:Bcam	UTSW	7	19765618	missense	probably null	1.00
R1813:Bcam	UTSW	7	19766715	missense	probably damaging	1.00
R1896:Bcam	UTSW	7	19766715	missense	probably damaging	1.00
R2016:Bcam	UTSW	7	19760349	missense	probably benign	0.38
R2117:Bcam	UTSW	7	19758427	missense	possibly damaging	0.71
R3713:Bcam	UTSW	7	19764193	missense	probably benign	0.12
R3917:Bcam	UTSW	7	19765450	missense	probably damaging	1.00
R4596:Bcam	UTSW	7	19764157	missense	probably damaging	0.97
R4866:Bcam	UTSW	7	19765472	missense	probably benign	0.00
R4874:Bcam	UTSW	7	19769322	intron	probably benign
R5062:Bcam	UTSW	7	19760101	missense	possibly damaging	0.62
R6783:Bcam	UTSW	7	19766881	missense	probably damaging	1.00
R6853:Bcam	UTSW	7	19760406	missense	probably damaging	1.00
R7016:Bcam	UTSW	7	19758443	nonsense	probably null
R7174:Bcam	UTSW	7	19765451	missense	probably damaging	1.00
R7237:Bcam	UTSW	7	19769307	splice site	probably null
R7733:Bcam	UTSW	7	19760388	missense	probably benign	0.00
R7938:Bcam	UTSW	7	19756813	missense	probably benign	0.08
R8474:Bcam	UTSW	7	19760400	nonsense	probably null
R8514:Bcam	UTSW	7	19758541	missense	probably damaging	1.00
R8880:Bcam	UTSW	7	19758746	missense	probably damaging	1.00
Z1177:Bcam	UTSW	7	19760107	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTTAGCTGGTTCCATTG -3'
(R):5'- TACAGTTGTCACCTGAGACCAAC -3'

Sequencing Primer
(F):5'- AGCTGGTTCCATTGGACAC -3'
(R):5'- GTTGTCACCTGAGACCAACCAAATC -3'

Posted On

2016-06-06