Incidental Mutation 'R5054:Bcam'
ID390704
Institutional Source Beutler Lab
Gene Symbol Bcam
Ensembl Gene ENSMUSG00000002980
Gene Namebasal cell adhesion molecule
Synonyms1200005K12Rik, Lu, B-CAM
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19756131-19771016 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 19756860 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003061]
Predicted Effect probably benign
Transcript: ENSMUST00000003061
SMART Domains Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 137 3.1e-9 SMART
IG_like 174 254 1.89e1 SMART
IGc2 275 337 2.58e-6 SMART
IGc2 369 425 2.16e-8 SMART
IG_like 458 523 7.29e-2 SMART
transmembrane domain 541 563 N/A INTRINSIC
low complexity region 601 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208280
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptar1 G T 19: 23,694,365 R44L probably damaging Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Bcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcam APN 7 19756799 missense probably benign 0.02
IGL01433:Bcam APN 7 19760182 missense possibly damaging 0.75
IGL01712:Bcam APN 7 19758767 missense probably damaging 0.99
IGL01943:Bcam APN 7 19765498 missense probably damaging 1.00
IGL01946:Bcam APN 7 19760117 nonsense probably null
IGL02281:Bcam APN 7 19758691 missense probably damaging 1.00
IGL02714:Bcam APN 7 19758807 splice site probably benign
IGL02837:Bcam UTSW 7 19764186 missense probably damaging 1.00
PIT4514001:Bcam UTSW 7 19764066 missense probably benign 0.06
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R1500:Bcam UTSW 7 19758964 missense possibly damaging 0.75
R1575:Bcam UTSW 7 19760382 missense possibly damaging 0.87
R1585:Bcam UTSW 7 19760186 missense probably damaging 1.00
R1768:Bcam UTSW 7 19765618 missense probably null 1.00
R1813:Bcam UTSW 7 19766715 missense probably damaging 1.00
R1896:Bcam UTSW 7 19766715 missense probably damaging 1.00
R2016:Bcam UTSW 7 19760349 missense probably benign 0.38
R2117:Bcam UTSW 7 19758427 missense possibly damaging 0.71
R3713:Bcam UTSW 7 19764193 missense probably benign 0.12
R3917:Bcam UTSW 7 19765450 missense probably damaging 1.00
R4596:Bcam UTSW 7 19764157 missense probably damaging 0.97
R4866:Bcam UTSW 7 19765472 missense probably benign 0.00
R4874:Bcam UTSW 7 19769322 intron probably benign
R5062:Bcam UTSW 7 19760101 missense possibly damaging 0.62
R6783:Bcam UTSW 7 19766881 missense probably damaging 1.00
R6853:Bcam UTSW 7 19760406 missense probably damaging 1.00
R7016:Bcam UTSW 7 19758443 nonsense probably null
R7174:Bcam UTSW 7 19765451 missense probably damaging 1.00
R7237:Bcam UTSW 7 19769307 intron probably null
R7733:Bcam UTSW 7 19760388 missense probably benign 0.00
R7938:Bcam UTSW 7 19756813 missense probably benign 0.08
Z1177:Bcam UTSW 7 19760107 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTTAGCTGGTTCCATTG -3'
(R):5'- TACAGTTGTCACCTGAGACCAAC -3'

Sequencing Primer
(F):5'- AGCTGGTTCCATTGGACAC -3'
(R):5'- GTTGTCACCTGAGACCAACCAAATC -3'
Posted On2016-06-06