Incidental Mutation 'R5054:Birc6'
ID 390738
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Name baculoviral IAP repeat-containing 6
Synonyms D630005A10Rik, A430032G04Rik, apollon, Bruce, A430040A19Rik
MMRRC Submission 042644-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5054 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74835290-75010351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74962320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 3978 (H3978R)
Ref Sequence ENSEMBL: ENSMUSP00000138693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182817] [ENSMUST00000182944] [ENSMUST00000183224]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000180037
AA Change: H3984R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: H3984R

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182133
AA Change: H3978R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: H3978R

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182147
Predicted Effect probably damaging
Transcript: ENSMUST00000182597
AA Change: H3993R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: H3993R

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182817
SMART Domains Protein: ENSMUSP00000138349
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 63 82 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182944
AA Change: H3980R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: H3980R

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183010
Predicted Effect probably damaging
Transcript: ENSMUST00000183224
AA Change: H3964R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: H3964R

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000183249
AA Change: H95R
Meta Mutation Damage Score 0.4113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,837,315 (GRCm39) Y257H probably damaging Het
Adam28 C T 14: 68,855,164 (GRCm39) C659Y probably damaging Het
Adamtsl2 G A 2: 26,991,732 (GRCm39) E627K probably damaging Het
Atad5 T A 11: 79,985,502 (GRCm39) S196R probably benign Het
Bcam T A 7: 19,490,785 (GRCm39) probably benign Het
Btbd7 T C 12: 102,804,471 (GRCm39) I190V probably benign Het
Ccdc8 T C 7: 16,728,970 (GRCm39) V153A probably damaging Het
Cyp2a5 C G 7: 26,540,529 (GRCm39) R68G probably damaging Het
Dock3 T C 9: 106,815,105 (GRCm39) Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 (GRCm39) E2794G possibly damaging Het
Dytn C A 1: 63,700,318 (GRCm39) V271L possibly damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif2s2 A C 2: 154,734,590 (GRCm39) probably null Het
Fndc7 A G 3: 108,788,663 (GRCm39) S193P probably damaging Het
Fzr1 G A 10: 81,207,253 (GRCm39) probably benign Het
Gm17472 T C 6: 42,957,938 (GRCm39) I69T probably damaging Het
Gmppa C A 1: 75,416,015 (GRCm39) Y137* probably null Het
Gpr45 A G 1: 43,071,809 (GRCm39) I151V probably benign Het
H1f0 G A 15: 78,912,973 (GRCm39) A18T probably damaging Het
Hbb-bh1 C T 7: 103,491,063 (GRCm39) V114I probably benign Het
Impa2 C A 18: 67,439,797 (GRCm39) P98Q probably damaging Het
Kazn T C 4: 141,835,957 (GRCm39) N573D unknown Het
Kcna2 A T 3: 107,011,656 (GRCm39) D79V probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kif13a A G 13: 46,956,122 (GRCm39) Y561H probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra1 T A 6: 130,352,247 (GRCm39) Q165L probably damaging Het
Mat2b T A 11: 40,570,869 (GRCm39) R318S probably damaging Het
Mgat4d G A 8: 84,094,837 (GRCm39) probably null Het
Mtor T A 4: 148,641,312 (GRCm39) probably null Het
Nostrin A T 2: 69,006,057 (GRCm39) Q247L possibly damaging Het
Obi1 C T 14: 104,745,466 (GRCm39) G70E probably damaging Het
Obscn T C 11: 58,964,443 (GRCm39) E3033G probably damaging Het
Pam C A 1: 97,749,642 (GRCm39) D839Y probably damaging Het
Pds5a A G 5: 65,795,157 (GRCm39) V693A probably damaging Het
Pigo A T 4: 43,021,337 (GRCm39) L535Q probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Ptar1 G T 19: 23,671,729 (GRCm39) R44L probably damaging Het
Rad51c T C 11: 87,288,580 (GRCm39) H201R probably benign Het
Rims2 A T 15: 39,381,265 (GRCm39) probably null Het
Rpl22l1 T G 3: 28,860,985 (GRCm39) S67A possibly damaging Het
Rps10 A G 17: 27,849,454 (GRCm39) S143P probably damaging Het
Rundc1 T C 11: 101,315,967 (GRCm39) V13A probably benign Het
Sephs2 C A 7: 126,872,564 (GRCm39) M176I probably benign Het
Serpina16 C T 12: 103,641,189 (GRCm39) V179I probably benign Het
Serpini2 T A 3: 75,166,784 (GRCm39) T158S probably damaging Het
Slc12a3 A G 8: 95,072,979 (GRCm39) R701G probably damaging Het
Slc1a6 A G 10: 78,650,436 (GRCm39) E558G probably damaging Het
Ssx2ip T C 3: 146,136,672 (GRCm39) probably benign Het
Tbr1 A T 2: 61,636,346 (GRCm39) I241F possibly damaging Het
Tgfa G C 6: 86,247,064 (GRCm39) probably null Het
Tlr12 T A 4: 128,511,063 (GRCm39) K396* probably null Het
Tmppe A G 9: 114,235,026 (GRCm39) I442V probably benign Het
Tubb3 T C 8: 124,147,607 (GRCm39) V180A probably damaging Het
Vmn1r222 A G 13: 23,416,901 (GRCm39) V104A probably damaging Het
Vmn2r95 G T 17: 18,671,708 (GRCm39) V482L possibly damaging Het
Zfp184 G T 13: 22,143,452 (GRCm39) R386L possibly damaging Het
Zfp444 T A 7: 6,192,792 (GRCm39) V270E probably damaging Het
Zfp985 A T 4: 147,667,438 (GRCm39) Y102F probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74,880,558 (GRCm39) splice site probably benign
IGL00542:Birc6 APN 17 74,930,766 (GRCm39) splice site probably null
IGL00659:Birc6 APN 17 74,967,648 (GRCm39) missense probably damaging 1.00
IGL00710:Birc6 APN 17 74,916,084 (GRCm39) missense probably benign 0.37
IGL00806:Birc6 APN 17 74,918,524 (GRCm39) missense possibly damaging 0.85
IGL00848:Birc6 APN 17 75,003,388 (GRCm39) nonsense probably null
IGL01071:Birc6 APN 17 74,873,127 (GRCm39) missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74,938,696 (GRCm39) missense probably damaging 1.00
IGL01121:Birc6 APN 17 74,938,033 (GRCm39) missense probably benign 0.08
IGL01132:Birc6 APN 17 74,910,055 (GRCm39) missense probably damaging 1.00
IGL01323:Birc6 APN 17 74,929,920 (GRCm39) missense probably damaging 1.00
IGL01444:Birc6 APN 17 74,938,682 (GRCm39) missense probably damaging 1.00
IGL01511:Birc6 APN 17 74,933,998 (GRCm39) nonsense probably null
IGL01576:Birc6 APN 17 74,984,365 (GRCm39) missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74,955,192 (GRCm39) missense probably benign 0.08
IGL01649:Birc6 APN 17 74,911,541 (GRCm39) missense probably benign 0.03
IGL01657:Birc6 APN 17 74,967,606 (GRCm39) missense probably damaging 1.00
IGL01739:Birc6 APN 17 74,966,216 (GRCm39) missense probably benign
IGL01756:Birc6 APN 17 74,947,203 (GRCm39) missense probably benign 0.00
IGL01807:Birc6 APN 17 74,938,032 (GRCm39) missense probably benign
IGL01885:Birc6 APN 17 74,911,511 (GRCm39) missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74,945,353 (GRCm39) missense probably damaging 1.00
IGL01915:Birc6 APN 17 74,938,715 (GRCm39) missense probably benign 0.34
IGL01998:Birc6 APN 17 74,886,880 (GRCm39) missense probably benign 0.06
IGL02084:Birc6 APN 17 74,915,277 (GRCm39) missense probably benign 0.45
IGL02086:Birc6 APN 17 74,946,822 (GRCm39) missense probably damaging 1.00
IGL02161:Birc6 APN 17 74,855,832 (GRCm39) missense probably damaging 0.99
IGL02195:Birc6 APN 17 75,004,376 (GRCm39) splice site probably benign
IGL02283:Birc6 APN 17 74,906,935 (GRCm39) missense probably benign
IGL02476:Birc6 APN 17 75,003,386 (GRCm39) missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74,959,054 (GRCm39) unclassified probably benign
IGL02547:Birc6 APN 17 74,886,640 (GRCm39) missense probably benign 0.21
IGL02678:Birc6 APN 17 74,956,898 (GRCm39) missense probably damaging 1.00
IGL02713:Birc6 APN 17 74,886,319 (GRCm39) missense probably benign
IGL02851:Birc6 APN 17 74,916,184 (GRCm39) missense probably damaging 1.00
IGL02875:Birc6 APN 17 74,896,713 (GRCm39) missense probably damaging 1.00
IGL02985:Birc6 APN 17 74,947,185 (GRCm39) missense probably benign 0.00
IGL03004:Birc6 APN 17 74,919,180 (GRCm39) missense probably benign 0.10
IGL03053:Birc6 APN 17 74,872,967 (GRCm39) missense probably damaging 1.00
IGL03085:Birc6 APN 17 74,903,945 (GRCm39) missense probably damaging 0.97
IGL03109:Birc6 APN 17 74,886,329 (GRCm39) missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74,905,994 (GRCm39) missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74,966,226 (GRCm39) missense probably benign
IGL03221:Birc6 APN 17 74,934,002 (GRCm39) missense probably benign 0.00
IGL03230:Birc6 APN 17 74,918,065 (GRCm39) missense probably damaging 1.00
IGL03294:Birc6 APN 17 74,956,881 (GRCm39) missense probably benign 0.02
IGL03399:Birc6 APN 17 74,901,368 (GRCm39) missense probably benign 0.01
Badlands UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
Big_sky UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
bitterroot UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
Black_hills UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
bottomlands UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
Chai UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
Dakota UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
Sempervirens UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
E0370:Birc6 UTSW 17 74,984,352 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
PIT4494001:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R0081:Birc6 UTSW 17 74,950,436 (GRCm39) missense probably benign 0.01
R0086:Birc6 UTSW 17 74,900,161 (GRCm39) missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74,945,371 (GRCm39) missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74,930,741 (GRCm39) splice site probably benign
R0129:Birc6 UTSW 17 74,835,755 (GRCm39) missense probably benign 0.05
R0196:Birc6 UTSW 17 74,887,282 (GRCm39) missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74,916,322 (GRCm39) missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74,969,827 (GRCm39) splice site probably benign
R0295:Birc6 UTSW 17 74,920,357 (GRCm39) intron probably benign
R0386:Birc6 UTSW 17 74,906,335 (GRCm39) missense probably damaging 0.99
R0423:Birc6 UTSW 17 75,003,292 (GRCm39) missense probably damaging 1.00
R0449:Birc6 UTSW 17 74,999,290 (GRCm39) missense probably damaging 1.00
R0453:Birc6 UTSW 17 74,956,749 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,969,620 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,959,023 (GRCm39) missense probably benign
R0564:Birc6 UTSW 17 74,932,238 (GRCm39) splice site probably benign
R0575:Birc6 UTSW 17 74,996,232 (GRCm39) missense probably damaging 1.00
R0582:Birc6 UTSW 17 74,950,332 (GRCm39) missense probably damaging 1.00
R0624:Birc6 UTSW 17 74,887,344 (GRCm39) missense probably benign 0.20
R0973:Birc6 UTSW 17 74,872,856 (GRCm39) missense probably damaging 0.99
R1061:Birc6 UTSW 17 74,996,307 (GRCm39) missense probably damaging 1.00
R1378:Birc6 UTSW 17 74,967,450 (GRCm39) missense probably damaging 1.00
R1402:Birc6 UTSW 17 75,004,528 (GRCm39) splice site probably benign
R1436:Birc6 UTSW 17 74,959,700 (GRCm39) missense probably damaging 1.00
R1456:Birc6 UTSW 17 74,916,285 (GRCm39) missense probably benign 0.35
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1474:Birc6 UTSW 17 74,886,673 (GRCm39) missense probably damaging 0.98
R1479:Birc6 UTSW 17 74,941,848 (GRCm39) missense probably damaging 1.00
R1486:Birc6 UTSW 17 74,946,815 (GRCm39) missense probably damaging 1.00
R1499:Birc6 UTSW 17 74,919,314 (GRCm39) missense probably damaging 1.00
R1515:Birc6 UTSW 17 74,835,631 (GRCm39) nonsense probably null
R1549:Birc6 UTSW 17 74,969,737 (GRCm39) missense probably damaging 1.00
R1559:Birc6 UTSW 17 74,999,232 (GRCm39) missense probably damaging 1.00
R1573:Birc6 UTSW 17 74,967,685 (GRCm39) splice site probably benign
R1615:Birc6 UTSW 17 74,916,404 (GRCm39) splice site probably null
R1621:Birc6 UTSW 17 74,977,245 (GRCm39) missense probably benign
R1680:Birc6 UTSW 17 74,855,741 (GRCm39) missense probably benign 0.01
R1743:Birc6 UTSW 17 74,886,751 (GRCm39) missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74,947,008 (GRCm39) missense probably damaging 1.00
R1775:Birc6 UTSW 17 74,919,281 (GRCm39) missense probably damaging 1.00
R1818:Birc6 UTSW 17 74,956,844 (GRCm39) missense probably damaging 1.00
R1836:Birc6 UTSW 17 74,921,385 (GRCm39) missense probably benign 0.41
R1931:Birc6 UTSW 17 74,872,977 (GRCm39) missense probably damaging 0.99
R1939:Birc6 UTSW 17 74,977,332 (GRCm39) missense probably damaging 1.00
R1964:Birc6 UTSW 17 74,941,880 (GRCm39) missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74,905,057 (GRCm39) missense probably benign 0.01
R2000:Birc6 UTSW 17 74,911,614 (GRCm39) missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
R2090:Birc6 UTSW 17 74,969,791 (GRCm39) missense probably benign
R2130:Birc6 UTSW 17 74,966,149 (GRCm39) splice site probably benign
R2144:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74,942,790 (GRCm39) missense probably benign 0.02
R2180:Birc6 UTSW 17 74,919,146 (GRCm39) missense probably benign 0.03
R2271:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2272:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2416:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2421:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2422:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2513:Birc6 UTSW 17 74,954,724 (GRCm39) missense probably damaging 0.97
R2912:Birc6 UTSW 17 74,999,201 (GRCm39) missense probably damaging 1.00
R3024:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3772:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3829:Birc6 UTSW 17 74,962,173 (GRCm39) missense probably damaging 1.00
R3913:Birc6 UTSW 17 74,880,608 (GRCm39) nonsense probably null
R3915:Birc6 UTSW 17 74,886,603 (GRCm39) missense probably benign 0.12
R3921:Birc6 UTSW 17 74,934,014 (GRCm39) missense probably damaging 0.98
R3928:Birc6 UTSW 17 74,945,404 (GRCm39) missense probably damaging 1.00
R3928:Birc6 UTSW 17 74,918,170 (GRCm39) missense possibly damaging 0.91
R4111:Birc6 UTSW 17 74,873,010 (GRCm39) missense probably damaging 1.00
R4155:Birc6 UTSW 17 74,903,934 (GRCm39) missense probably benign 0.00
R4163:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R4226:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4227:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4358:Birc6 UTSW 17 74,926,663 (GRCm39) splice site probably null
R4524:Birc6 UTSW 17 74,948,772 (GRCm39) missense probably damaging 1.00
R4605:Birc6 UTSW 17 74,946,929 (GRCm39) missense probably damaging 1.00
R4619:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4620:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4762:Birc6 UTSW 17 74,936,484 (GRCm39) missense probably damaging 1.00
R4814:Birc6 UTSW 17 74,956,667 (GRCm39) missense probably damaging 1.00
R4849:Birc6 UTSW 17 74,954,383 (GRCm39) missense probably damaging 0.99
R4869:Birc6 UTSW 17 74,893,007 (GRCm39) missense probably benign 0.05
R4912:Birc6 UTSW 17 74,872,900 (GRCm39) missense probably damaging 1.00
R4921:Birc6 UTSW 17 74,957,094 (GRCm39) missense probably damaging 1.00
R4942:Birc6 UTSW 17 74,930,045 (GRCm39) missense probably damaging 1.00
R4954:Birc6 UTSW 17 74,919,026 (GRCm39) missense probably damaging 1.00
R4992:Birc6 UTSW 17 74,996,251 (GRCm39) missense probably benign 0.44
R4994:Birc6 UTSW 17 74,901,319 (GRCm39) intron probably benign
R5018:Birc6 UTSW 17 74,947,054 (GRCm39) missense probably damaging 1.00
R5022:Birc6 UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
R5068:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5069:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5070:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5196:Birc6 UTSW 17 74,913,136 (GRCm39) splice site probably benign
R5209:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5212:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5216:Birc6 UTSW 17 74,920,465 (GRCm39) missense probably damaging 1.00
R5279:Birc6 UTSW 17 74,957,042 (GRCm39) missense probably damaging 0.98
R5286:Birc6 UTSW 17 74,977,242 (GRCm39) missense probably damaging 1.00
R5399:Birc6 UTSW 17 74,911,573 (GRCm39) missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74,969,685 (GRCm39) missense probably damaging 1.00
R5482:Birc6 UTSW 17 74,948,777 (GRCm39) missense possibly damaging 0.86
R5492:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5504:Birc6 UTSW 17 74,962,208 (GRCm39) missense probably damaging 1.00
R5519:Birc6 UTSW 17 74,887,173 (GRCm39) missense probably benign
R5544:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5608:Birc6 UTSW 17 74,920,539 (GRCm39) missense probably damaging 0.99
R5623:Birc6 UTSW 17 74,835,651 (GRCm39) missense probably damaging 0.99
R5701:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R5707:Birc6 UTSW 17 75,003,399 (GRCm39) missense probably damaging 1.00
R5715:Birc6 UTSW 17 74,938,615 (GRCm39) missense probably damaging 1.00
R5734:Birc6 UTSW 17 74,925,419 (GRCm39) splice site probably benign
R5792:Birc6 UTSW 17 74,938,048 (GRCm39) missense probably benign 0.05
R5809:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5810:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5813:Birc6 UTSW 17 74,953,497 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,232 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,233 (GRCm39) missense probably damaging 0.98
R5960:Birc6 UTSW 17 74,835,760 (GRCm39) missense probably damaging 0.97
R5961:Birc6 UTSW 17 74,953,596 (GRCm39) missense probably damaging 1.00
R5967:Birc6 UTSW 17 74,967,434 (GRCm39) missense probably damaging 0.99
R5970:Birc6 UTSW 17 74,925,497 (GRCm39) missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
R5982:Birc6 UTSW 17 74,955,153 (GRCm39) missense probably benign
R6023:Birc6 UTSW 17 74,961,372 (GRCm39) missense probably benign 0.24
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6243:Birc6 UTSW 17 74,916,382 (GRCm39) missense probably damaging 0.96
R6294:Birc6 UTSW 17 74,996,252 (GRCm39) missense probably benign 0.00
R6327:Birc6 UTSW 17 74,969,774 (GRCm39) missense probably damaging 1.00
R6501:Birc6 UTSW 17 74,886,276 (GRCm39) missense probably damaging 1.00
R6810:Birc6 UTSW 17 74,919,215 (GRCm39) missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
R6822:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
R6835:Birc6 UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
R6945:Birc6 UTSW 17 74,886,526 (GRCm39) missense probably benign 0.04
R6957:Birc6 UTSW 17 74,886,486 (GRCm39) missense probably benign
R6989:Birc6 UTSW 17 74,937,984 (GRCm39) missense probably benign 0.18
R6991:Birc6 UTSW 17 74,869,090 (GRCm39) missense probably damaging 1.00
R7019:Birc6 UTSW 17 74,916,340 (GRCm39) missense probably benign 0.01
R7092:Birc6 UTSW 17 74,953,740 (GRCm39) missense probably damaging 1.00
R7158:Birc6 UTSW 17 74,901,371 (GRCm39) missense probably benign 0.25
R7204:Birc6 UTSW 17 74,947,103 (GRCm39) missense probably damaging 1.00
R7267:Birc6 UTSW 17 74,892,980 (GRCm39) missense probably benign 0.00
R7316:Birc6 UTSW 17 74,911,489 (GRCm39) missense probably damaging 0.99
R7341:Birc6 UTSW 17 74,919,069 (GRCm39) missense probably damaging 1.00
R7404:Birc6 UTSW 17 74,946,789 (GRCm39) missense possibly damaging 0.73
R7449:Birc6 UTSW 17 75,009,336 (GRCm39) missense probably benign
R7498:Birc6 UTSW 17 74,967,465 (GRCm39) missense probably damaging 1.00
R7539:Birc6 UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
R7569:Birc6 UTSW 17 74,905,077 (GRCm39) missense possibly damaging 0.71
R7574:Birc6 UTSW 17 74,886,879 (GRCm39) missense probably benign
R7611:Birc6 UTSW 17 74,969,713 (GRCm39) missense probably damaging 0.98
R7653:Birc6 UTSW 17 74,954,729 (GRCm39) missense possibly damaging 0.91
R7716:Birc6 UTSW 17 74,869,056 (GRCm39) missense probably damaging 0.99
R7728:Birc6 UTSW 17 74,929,100 (GRCm39) missense probably benign 0.01
R7810:Birc6 UTSW 17 74,855,815 (GRCm39) missense probably damaging 0.98
R7828:Birc6 UTSW 17 74,886,501 (GRCm39) missense probably damaging 0.97
R7881:Birc6 UTSW 17 74,948,666 (GRCm39) missense probably damaging 0.99
R7896:Birc6 UTSW 17 74,929,077 (GRCm39) missense probably damaging 0.99
R7950:Birc6 UTSW 17 74,900,095 (GRCm39) missense probably damaging 1.00
R7988:Birc6 UTSW 17 74,906,368 (GRCm39) splice site probably null
R8073:Birc6 UTSW 17 74,910,080 (GRCm39) missense probably damaging 1.00
R8128:Birc6 UTSW 17 74,916,253 (GRCm39) missense probably damaging 1.00
R8167:Birc6 UTSW 17 74,950,389 (GRCm39) missense probably damaging 1.00
R8236:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8237:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8255:Birc6 UTSW 17 74,969,775 (GRCm39) missense probably damaging 0.99
R8259:Birc6 UTSW 17 74,905,073 (GRCm39) missense probably benign 0.01
R8297:Birc6 UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
R8376:Birc6 UTSW 17 74,896,635 (GRCm39) missense probably benign 0.18
R8413:Birc6 UTSW 17 74,853,388 (GRCm39) missense possibly damaging 0.54
R8503:Birc6 UTSW 17 74,999,239 (GRCm39) missense probably damaging 1.00
R8504:Birc6 UTSW 17 74,959,000 (GRCm39) missense probably damaging 0.98
R8543:Birc6 UTSW 17 74,872,860 (GRCm39) missense probably damaging 1.00
R8550:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8551:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8556:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8683:Birc6 UTSW 17 74,916,114 (GRCm39) missense possibly damaging 0.74
R8751:Birc6 UTSW 17 74,955,135 (GRCm39) missense probably damaging 0.98
R8803:Birc6 UTSW 17 74,959,033 (GRCm39) missense probably damaging 0.99
R8806:Birc6 UTSW 17 74,949,311 (GRCm39) missense probably damaging 1.00
R8825:Birc6 UTSW 17 74,920,500 (GRCm39) missense probably damaging 0.99
R8888:Birc6 UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
R8972:Birc6 UTSW 17 75,009,313 (GRCm39) missense probably benign 0.05
R9069:Birc6 UTSW 17 74,868,260 (GRCm39) splice site probably benign
R9111:Birc6 UTSW 17 74,966,340 (GRCm39) missense probably damaging 0.99
R9130:Birc6 UTSW 17 74,919,146 (GRCm39) missense
R9352:Birc6 UTSW 17 74,965,347 (GRCm39) critical splice donor site probably null
R9354:Birc6 UTSW 17 74,921,401 (GRCm39) missense probably benign
R9432:Birc6 UTSW 17 74,966,216 (GRCm39) missense probably benign
R9446:Birc6 UTSW 17 74,925,491 (GRCm39) missense probably damaging 1.00
R9485:Birc6 UTSW 17 74,945,398 (GRCm39) missense probably damaging 1.00
R9499:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9551:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9552:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9585:Birc6 UTSW 17 74,916,265 (GRCm39) missense probably damaging 1.00
R9647:Birc6 UTSW 17 74,999,305 (GRCm39) missense probably damaging 1.00
R9648:Birc6 UTSW 17 74,938,696 (GRCm39) missense probably damaging 1.00
R9667:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R9696:Birc6 UTSW 17 74,947,292 (GRCm39) missense probably damaging 0.99
RF016:Birc6 UTSW 17 74,996,319 (GRCm39) missense probably damaging 1.00
Z1088:Birc6 UTSW 17 74,918,537 (GRCm39) missense probably damaging 0.99
Z1177:Birc6 UTSW 17 74,954,275 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TATGGCATGCCTAAAAGATCAGG -3'
(R):5'- CTTTACCATCTGTGCTCAAAGC -3'

Sequencing Primer
(F):5'- AATGATTTGGTGTTAGGAATGCC -3'
(R):5'- GCTCAAAGCAAGGGTAAAGAAG -3'
Posted On 2016-06-06