Incidental Mutation 'R4824:Anapc1'
ID406161
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission 042440-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4824 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128628690 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1507 (T1507S)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: T1507S

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: T1507S

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154995
Meta Mutation Damage Score 0.1707 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,676 T209A probably benign Het
1700086D15Rik T C 11: 65,152,615 probably benign Het
4930452B06Rik A T 14: 8,665,997 M1K probably null Het
A130010J15Rik G A 1: 193,174,657 V106I probably benign Het
Abca16 C A 7: 120,475,479 N580K possibly damaging Het
Actrt2 A T 4: 154,666,887 F264Y probably damaging Het
Adh4 G A 3: 138,429,046 S327N possibly damaging Het
Alkbh5 T C 11: 60,553,871 probably null Het
Anapc2 A G 2: 25,277,752 R444G probably damaging Het
Apoh G T 11: 108,414,261 W335L probably benign Het
B4galt7 A T 13: 55,604,349 H71L possibly damaging Het
Bicd2 A G 13: 49,379,012 E358G probably damaging Het
Bmper T A 9: 23,223,660 V7D possibly damaging Het
Brca2 T C 5: 150,539,735 F988S probably damaging Het
Brix1 A G 15: 10,485,742 V49A possibly damaging Het
Brpf3 T C 17: 28,806,486 S178P probably benign Het
Btaf1 A G 19: 36,981,048 Y655C possibly damaging Het
C1rl C G 6: 124,509,081 Y470* probably null Het
Cacnb4 A G 2: 52,675,810 V21A probably benign Het
Caskin1 C A 17: 24,501,129 P437T probably benign Het
Casz1 C A 4: 148,944,571 P1158T probably damaging Het
Ccdc141 T A 2: 77,124,336 Q189L probably damaging Het
Ccr3 T C 9: 124,028,772 V48A probably damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Chd1 C A 17: 15,733,124 S440R probably damaging Het
Clip1 T A 5: 123,631,023 E504D probably damaging Het
Cmya5 T C 13: 93,093,574 R1669G probably benign Het
Col11a2 T A 17: 34,050,963 F456I probably damaging Het
Col4a3bp C T 13: 96,616,487 P350S probably benign Het
Ctnna2 A T 6: 76,980,781 M130K probably damaging Het
Elmo2 A T 2: 165,292,002 probably benign Het
F11 T C 8: 45,255,342 D27G probably damaging Het
Faap100 A T 11: 120,375,586 probably null Het
Fat1 A G 8: 44,989,114 E1151G probably damaging Het
Fbll1 T A 11: 35,797,825 I204F probably damaging Het
Gle1 T A 2: 29,940,203 V257D possibly damaging Het
Hoxc9 T A 15: 102,981,793 C47* probably null Het
Hsd17b6 A G 10: 127,993,655 V226A probably benign Het
Hsd17b7 C T 1: 169,961,195 R151Q probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ido2 A G 8: 24,533,859 I321T probably benign Het
Irf2bp2 T C 8: 126,591,433 T465A probably benign Het
Kdm2a A G 19: 4,362,787 M34T probably damaging Het
Klhl6 C T 16: 19,957,028 R260H probably damaging Het
Kntc1 T A 5: 123,790,133 L1231* probably null Het
Lca5l A C 16: 96,162,029 Y412* probably null Het
Lipt1 T C 1: 37,875,432 S190P possibly damaging Het
Ly6f T A 15: 75,271,720 V92D probably damaging Het
Matn4 T A 2: 164,393,231 M433L probably benign Het
Mbtd1 C A 11: 93,925,702 P370T probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Muc5b T A 7: 141,864,185 C3623S probably damaging Het
Myt1l C A 12: 29,849,400 H134N probably benign Het
Nav2 A T 7: 49,409,001 probably benign Het
Ndufaf8 T C 11: 120,099,166 C35R probably damaging Het
Neb G A 2: 52,204,879 T5130I possibly damaging Het
Nlrp9c T C 7: 26,380,564 N624S possibly damaging Het
Nr0b2 C A 4: 133,556,023 H190Q probably damaging Het
Nrg4 A G 9: 55,249,121 probably benign Het
Nup88 A T 11: 70,961,624 V215E probably benign Het
Oas2 T G 5: 120,738,346 T511P probably benign Het
Olfr1151 T C 2: 87,857,277 V34A probably benign Het
Olfr1162 A C 2: 88,050,088 F179V probably damaging Het
Olfr1500 A C 19: 13,828,354 L14R probably damaging Het
Olfr384 A G 11: 73,602,600 T7A possibly damaging Het
Olfr720 A G 14: 14,175,885 S66P probably damaging Het
Olfr943 A G 9: 39,184,205 N9S probably benign Het
Pcdhgb2 T A 18: 37,690,449 N164K probably damaging Het
Pde4d C G 13: 109,116,866 P76A probably benign Het
Phlda1 T C 10: 111,507,655 probably benign Het
Plekhh1 A G 12: 79,054,803 T216A probably benign Het
Plppr3 T A 10: 79,865,673 E445V possibly damaging Het
Prom1 A G 5: 44,034,390 V337A probably damaging Het
Prr14l T C 5: 32,844,399 probably benign Het
Psmd1 A G 1: 86,137,098 I951V probably benign Het
Rab35 T G 5: 115,643,395 I85M possibly damaging Het
Rad9a A T 19: 4,200,537 S93T probably benign Het
Ric1 G A 19: 29,585,842 C555Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror2 T A 13: 53,110,683 Q791L probably benign Het
Rps8 G C 4: 117,155,155 probably benign Het
Sdr16c5 C T 4: 4,016,216 W70* probably null Het
Senp3 A G 11: 69,677,995 V408A probably benign Het
Sh2d4b C A 14: 40,840,344 W288L probably benign Het
Slc38a9 A T 13: 112,723,298 D422V probably damaging Het
Slc4a2 T C 5: 24,440,143 F1104L probably damaging Het
Slc4a3 A G 1: 75,550,623 K113E possibly damaging Het
Spata3 G A 1: 86,024,326 probably null Het
Spata31d1d A T 13: 59,729,241 V160E possibly damaging Het
Sprr2f A G 3: 92,365,896 M1V probably null Het
Sptbn1 A G 11: 30,118,295 V1733A possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tardbp A G 4: 148,617,593 I295T probably benign Het
Tmem212 A G 3: 27,885,008 S110P probably damaging Het
Tnc G A 4: 64,017,620 Q360* probably null Het
Tnrc6c C A 11: 117,722,905 Q630K probably damaging Het
Ttc19 G A 11: 62,309,096 R235H probably benign Het
Ube3b T A 5: 114,415,726 probably null Het
Vmn2r31 C T 7: 7,387,063 probably null Het
Vmn2r92 T A 17: 18,151,921 probably benign Het
Washc5 A T 15: 59,333,636 Y685* probably null Het
Wdr93 T A 7: 79,750,069 Y135* probably null Het
Wdr95 T A 5: 149,595,332 I546K probably damaging Het
Zbtb38 T A 9: 96,688,201 T277S probably benign Het
Zfp13 T C 17: 23,576,823 D258G possibly damaging Het
Zfp397 T A 18: 23,960,192 S245T probably benign Het
Zfp646 T C 7: 127,883,735 Y1695H probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 intron probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7922:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7930:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACATATATAGCTCTCCCTCATGAAC -3'
(R):5'- GCAAGATCATGCTGTATAAGGC -3'

Sequencing Primer
(F):5'- TTCCTCCTCCCAAAAAGAGAAGG -3'
(R):5'- CTTCCAAGTTCAGATATTTTTG -3'
Posted On2016-08-01