Incidental Mutation 'R5361:Afg3l2'
ID 422844
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
MMRRC Submission 042940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5361 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67421259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T A 9: 57,257,185 K635N probably damaging Het
Ahnak T A 19: 9,015,341 M4663K possibly damaging Het
C4b T A 17: 34,741,238 T280S probably benign Het
Ccdc166 A G 15: 75,981,020 V366A probably benign Het
Cdh23 A G 10: 60,657,265 probably null Het
Col7a1 A G 9: 108,963,224 T1281A unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Dbndd1 T A 8: 123,506,745 D127V probably damaging Het
Ddx20 T A 3: 105,683,509 E197V probably damaging Het
Dnm3 A G 1: 162,010,902 S826P probably damaging Het
Dnmt3a T C 12: 3,895,643 V24A probably benign Het
Dopey2 C A 16: 93,770,504 A1273E probably damaging Het
Dsg1c T C 18: 20,283,646 V868A possibly damaging Het
Dtx4 A G 19: 12,485,262 probably null Het
Elovl4 A G 9: 83,790,101 L55P possibly damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam45a A G 19: 60,825,886 M96V probably benign Het
Fbxo40 T A 16: 36,969,552 T399S possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm14399 T C 2: 175,131,578 E96G probably damaging Het
Gm14496 T G 2: 182,000,354 V606G probably benign Het
Gpr156 A G 16: 38,005,725 E768G probably damaging Het
Grm5 A T 7: 88,074,496 T665S probably damaging Het
Hsdl2 A G 4: 59,592,301 probably benign Het
Htt T C 5: 34,907,584 V3047A possibly damaging Het
Igkv3-2 A T 6: 70,699,027 T107S probably benign Het
Itih2 T A 2: 10,096,461 T899S probably benign Het
Lhcgr T A 17: 88,742,853 Y415F probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Med4 C A 14: 73,510,113 S18* probably null Het
Nefl T C 14: 68,084,639 V226A probably damaging Het
Nploc4 T A 11: 120,384,563 N516Y probably damaging Het
Olfr798 A T 10: 129,625,732 F110I probably damaging Het
Olfr99 A G 17: 37,279,610 V270A probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdha3 T G 18: 36,946,699 L165V possibly damaging Het
Pcdhb12 T A 18: 37,437,046 V415D probably damaging Het
Pcdhga10 T C 18: 37,747,450 I88T probably damaging Het
Pigyl T A 9: 22,157,996 M1K probably null Het
Prr27 T C 5: 87,843,344 S272P probably damaging Het
Prss3 C T 6: 41,373,846 D237N probably benign Het
Pstpip2 A G 18: 77,870,378 D150G probably damaging Het
Robo4 T A 9: 37,413,378 D909E probably benign Het
Serpinb3c A T 1: 107,276,931 Y28* probably null Het
Slc26a3 T C 12: 31,450,981 probably null Het
Slc6a1 A T 6: 114,302,532 I91F probably benign Het
Smcr8 T G 11: 60,778,292 Y89D probably damaging Het
Sspo T A 6: 48,466,313 M1898K probably benign Het
Tbl1xr1 T A 3: 22,192,069 I251K probably damaging Het
Thbs4 C T 13: 92,776,993 D140N probably benign Het
Tmbim6 G A 15: 99,405,752 A108T probably benign Het
Trim10 T G 17: 36,875,436 L301R probably benign Het
Trpm7 A T 2: 126,829,241 I607N possibly damaging Het
Vmn2r9 T A 5: 108,848,063 I240F probably damaging Het
Xpot T A 10: 121,600,860 I873F possibly damaging Het
Zfhx4 G A 3: 5,399,207 S1475N probably damaging Het
Zfp712 A G 13: 67,041,015 S483P possibly damaging Het
Zswim7 A T 11: 62,267,547 H122Q probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On 2016-08-04