Incidental Mutation 'R8479:Afg3l2'
ID 657456
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8479 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 67448916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 29 (G29D)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably benign
Transcript: ENSMUST00000025408
AA Change: G29D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: G29D

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,227,860 H241Y probably benign Het
Ano2 T C 6: 125,712,160 S52P possibly damaging Het
Atp11a A T 8: 12,842,932 E641V possibly damaging Het
Atp6v1d T C 12: 78,849,746 T116A probably benign Het
BC025446 A G 15: 75,217,777 T45A probably damaging Het
Cacna2d2 T C 9: 107,526,397 probably null Het
Cd109 T A 9: 78,667,346 Y537* probably null Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cntnap2 C T 6: 46,759,773 A711V probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Crhbp A G 13: 95,442,124 V163A possibly damaging Het
Crmp1 C A 5: 37,284,158 P414Q possibly damaging Het
Cse1l G A 2: 166,921,973 E78K possibly damaging Het
Ctnna2 A G 6: 77,758,590 V35A probably damaging Het
Ddx1 T A 12: 13,220,748 N654I probably damaging Het
Dgcr14 T C 16: 17,910,941 probably null Het
Dido1 A T 2: 180,673,229 probably null Het
Dmtf1 C T 5: 9,120,428 V630I probably damaging Het
Ercc6 T C 14: 32,526,406 S305P probably benign Het
Ercc6l2 T A 13: 63,824,815 S37T possibly damaging Het
Fnip2 A G 3: 79,512,555 M138T probably damaging Het
Galnt9 T C 5: 110,544,751 V17A probably benign Het
Gm7324 T C 14: 43,714,763 S288P probably benign Het
Gucy2e G A 11: 69,232,963 A370V probably benign Het
H2-Bl G A 17: 36,084,219 A2V probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Ipo7 G A 7: 110,039,245 V240I probably benign Het
Lrrc4c A G 2: 97,629,632 Y201C probably damaging Het
Mapkap1 A T 2: 34,581,290 S389C probably damaging Het
Met G T 6: 17,491,747 probably null Het
Misp T C 10: 79,827,916 F575L possibly damaging Het
Mtmr11 T C 3: 96,163,734 L136P probably damaging Het
Muc4 C T 16: 32,753,508 T1128M possibly damaging Het
Nfyc A T 4: 120,768,892 V70E probably damaging Het
Nphp4 T C 4: 152,524,290 S452P probably benign Het
Oasl2 T A 5: 114,897,791 F43I probably damaging Het
Olfr1002 A G 2: 85,648,103 S73P probably damaging Het
Olfr1333 A G 4: 118,830,015 C141R probably damaging Het
Pros1 G T 16: 62,907,739 G269W probably damaging Het
Rif1 A C 2: 52,112,551 S2006R possibly damaging Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rragd C T 4: 33,018,734 A379V probably benign Het
Slc10a2 C T 8: 5,098,443 probably null Het
Susd3 C T 13: 49,237,476 G113S probably benign Het
Tbc1d19 T A 5: 53,883,689 M371K possibly damaging Het
Tnn C A 1: 160,122,827 R736S probably benign Het
Trio T C 15: 27,901,200 T323A probably benign Het
Ubqln1 G A 13: 58,191,839 P324S probably benign Het
Uspl1 T C 5: 149,215,194 L1068P probably damaging Het
Vmn2r86 A T 10: 130,446,866 I627N probably damaging Het
Wdr35 C A 12: 8,985,985 T252K probably benign Het
Zfp62 T C 11: 49,216,492 I470T probably damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTTCCAGTGCCACGAAAGC -3'
(R):5'- TCCGAAGAACCGATAAGCTGC -3'

Sequencing Primer
(F):5'- GTGCCACGAAAGCCAACGAG -3'
(R):5'- ACCGATAAGCTGCGGAAG -3'
Posted On 2021-01-18