Incidental Mutation 'R5561:Ppp1r12c'
ID436592
Institutional Source Beutler Lab
Gene Symbol Ppp1r12c
Ensembl Gene ENSMUSG00000019254
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12C
Synonyms2410197A17Rik, Mbs85
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4481520-4501680 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 4486356 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013886] [ENSMUST00000013886] [ENSMUST00000124248] [ENSMUST00000124248] [ENSMUST00000125220]
Predicted Effect probably null
Transcript: ENSMUST00000013886
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000013886
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124248
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124248
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154710
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Ppp1r12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ppp1r12c APN 7 4497345 splice site probably benign
IGL01419:Ppp1r12c APN 7 4486352 splice site probably null
IGL02126:Ppp1r12c APN 7 4489859 missense probably benign 0.43
IGL03388:Ppp1r12c APN 7 4482070 unclassified probably benign
PIT4418001:Ppp1r12c UTSW 7 4501267 missense probably null 0.09
R0523:Ppp1r12c UTSW 7 4489772 missense probably damaging 1.00
R0815:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R0863:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R1413:Ppp1r12c UTSW 7 4484444 splice site probably null
R1522:Ppp1r12c UTSW 7 4497425 missense probably damaging 1.00
R1835:Ppp1r12c UTSW 7 4483651 missense probably damaging 1.00
R2004:Ppp1r12c UTSW 7 4482975 nonsense probably null
R2170:Ppp1r12c UTSW 7 4482806 missense possibly damaging 0.76
R3787:Ppp1r12c UTSW 7 4486584 missense probably damaging 1.00
R3833:Ppp1r12c UTSW 7 4482786 unclassified probably benign
R4093:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4095:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4108:Ppp1r12c UTSW 7 4486566 missense probably damaging 1.00
R5177:Ppp1r12c UTSW 7 4484496 nonsense probably null
R5319:Ppp1r12c UTSW 7 4483984 missense probably benign 0.01
R5739:Ppp1r12c UTSW 7 4497282 missense probably damaging 1.00
R5837:Ppp1r12c UTSW 7 4497404 intron probably benign
R6531:Ppp1r12c UTSW 7 4482789 critical splice donor site probably null
R7207:Ppp1r12c UTSW 7 4489868 missense probably damaging 1.00
R7507:Ppp1r12c UTSW 7 4483971 missense probably benign 0.01
R7920:Ppp1r12c UTSW 7 4483355 missense probably benign 0.00
R7934:Ppp1r12c UTSW 7 4485417 nonsense probably null
R8391:Ppp1r12c UTSW 7 4497432 missense probably damaging 1.00
R8397:Ppp1r12c UTSW 7 4489769 missense probably damaging 0.98
R8793:Ppp1r12c UTSW 7 4482888 missense probably benign
R8851:Ppp1r12c UTSW 7 4484704 missense probably damaging 1.00
Z1177:Ppp1r12c UTSW 7 4484629 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTGAAATTCCAGCCCATGCC -3'
(R):5'- AGCTGGCTATGACACAGAGC -3'

Sequencing Primer
(F):5'- ATCTGCCTGGGACCTGCATC -3'
(R):5'- CTATGACACAGAGCTCCGGGATG -3'
Posted On2016-10-24