Incidental Mutation 'R5561:Mllt10'
ID436575
Institutional Source Beutler Lab
Gene Symbol Mllt10
Ensembl Gene ENSMUSG00000026743
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
SynonymsAf10, D630001B22Rik, B130021D15Rik
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18055237-18212388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18109845 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 120 (M120K)
Ref Sequence ENSEMBL: ENSMUSP00000110328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028076] [ENSMUST00000114671] [ENSMUST00000114680]
Predicted Effect probably damaging
Transcript: ENSMUST00000028076
AA Change: M120K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743
AA Change: M120K

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114671
AA Change: M42K

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743
AA Change: M42K

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114680
AA Change: M120K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110328
Gene: ENSMUSG00000026743
AA Change: M120K

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154041
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Mllt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Mllt10 APN 2 18122317 missense probably damaging 1.00
IGL02366:Mllt10 APN 2 18065087 missense probably damaging 0.99
IGL02990:Mllt10 APN 2 18123711 splice site probably benign
IGL03034:Mllt10 APN 2 18065036 start codon destroyed probably null 0.55
R0348:Mllt10 UTSW 2 18162613 missense probably damaging 1.00
R0487:Mllt10 UTSW 2 18207137 missense probably damaging 0.98
R0492:Mllt10 UTSW 2 18146887 splice site probably benign
R0518:Mllt10 UTSW 2 18071206 critical splice donor site probably null
R0720:Mllt10 UTSW 2 18196595 missense probably benign
R0733:Mllt10 UTSW 2 18203766 intron probably benign
R1532:Mllt10 UTSW 2 18092835 critical splice donor site probably null
R1665:Mllt10 UTSW 2 18208790 missense possibly damaging 0.93
R1768:Mllt10 UTSW 2 18162846 missense probably damaging 1.00
R2098:Mllt10 UTSW 2 18162653 missense possibly damaging 0.50
R2114:Mllt10 UTSW 2 18162569 missense probably benign
R2116:Mllt10 UTSW 2 18162569 missense probably benign
R2117:Mllt10 UTSW 2 18162569 missense probably benign
R2179:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R2192:Mllt10 UTSW 2 18207060 missense probably benign 0.11
R2510:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R2511:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R4669:Mllt10 UTSW 2 18203633 missense probably damaging 1.00
R5004:Mllt10 UTSW 2 18170268 missense probably damaging 1.00
R5072:Mllt10 UTSW 2 18109874 missense possibly damaging 0.72
R5187:Mllt10 UTSW 2 18208774 nonsense probably null
R6141:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R6352:Mllt10 UTSW 2 18123793 missense probably damaging 1.00
R6844:Mllt10 UTSW 2 18159483 missense probably benign 0.02
R7060:Mllt10 UTSW 2 18159560 missense possibly damaging 0.64
R7464:Mllt10 UTSW 2 18170279 missense probably benign
R7691:Mllt10 UTSW 2 18203611 missense possibly damaging 0.94
R7691:Mllt10 UTSW 2 18203612 missense probably null 0.94
R8079:Mllt10 UTSW 2 18123756 missense probably damaging 0.99
R8084:Mllt10 UTSW 2 18109826 missense probably damaging 0.99
Z1177:Mllt10 UTSW 2 18171076 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCAGCCAGAGTTTTATTACGG -3'
(R):5'- GCAAGAGGTCAGTAAATCTTCAAAG -3'

Sequencing Primer
(F):5'- CAGCCAGAGTTTTATTACGGTTTTG -3'
(R):5'- GGCTCAAGATGGTAACTATTTTTCTC -3'
Posted On2016-10-24