Incidental Mutation 'R7183:Uggt2'
ID 568546
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene Name UDP-glucose glycoprotein glucosyltransferase 2
Synonyms 3110001A05Rik, A230065J02Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 119222451-119336842 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 119257049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
AlphaFold E9Q4X2
Predicted Effect probably benign
Transcript: ENSMUST00000127153
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153693
SMART Domains Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 106 3.3e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156203
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173391
SMART Domains Protein: ENSMUSP00000133772
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 2 63 9.4e-18 PFAM
SCOP:d1ga8a_ 77 216 3e-21 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Phlpp2 C A 8: 110,666,585 (GRCm39) P1038Q probably damaging Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119,286,688 (GRCm39) missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119,263,841 (GRCm39) nonsense probably null
IGL00433:Uggt2 APN 14 119,250,899 (GRCm39) missense probably benign
IGL00572:Uggt2 APN 14 119,280,203 (GRCm39) missense probably benign 0.02
IGL00577:Uggt2 APN 14 119,272,312 (GRCm39) missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119,280,211 (GRCm39) missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119,295,057 (GRCm39) missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119,280,184 (GRCm39) missense probably benign 0.00
IGL01787:Uggt2 APN 14 119,319,146 (GRCm39) missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119,326,605 (GRCm39) missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119,328,150 (GRCm39) missense probably benign 0.17
IGL02894:Uggt2 APN 14 119,319,211 (GRCm39) missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119,312,758 (GRCm39) missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119,332,722 (GRCm39) missense probably benign 0.25
IGL03142:Uggt2 APN 14 119,235,603 (GRCm39) missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119,315,080 (GRCm39) missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119,308,300 (GRCm39) missense probably benign 0.38
P0014:Uggt2 UTSW 14 119,281,950 (GRCm39) missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119,287,075 (GRCm39) missense probably benign 0.07
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0383:Uggt2 UTSW 14 119,286,863 (GRCm39) missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R0472:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119,295,010 (GRCm39) missense probably benign 0.27
R0788:Uggt2 UTSW 14 119,332,812 (GRCm39) splice site probably benign
R0940:Uggt2 UTSW 14 119,328,604 (GRCm39) critical splice donor site probably null
R1567:Uggt2 UTSW 14 119,246,505 (GRCm39) missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119,295,075 (GRCm39) missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119,292,055 (GRCm39) missense probably benign 0.19
R1746:Uggt2 UTSW 14 119,250,915 (GRCm39) missense probably benign 0.00
R1785:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119,269,688 (GRCm39) missense probably benign 0.00
R1894:Uggt2 UTSW 14 119,287,130 (GRCm39) missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119,245,467 (GRCm39) splice site probably benign
R2149:Uggt2 UTSW 14 119,312,757 (GRCm39) missense probably benign 0.02
R2168:Uggt2 UTSW 14 119,256,917 (GRCm39) missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2240:Uggt2 UTSW 14 119,232,461 (GRCm39) missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119,264,011 (GRCm39) missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119,296,521 (GRCm39) missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2907:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2908:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2998:Uggt2 UTSW 14 119,286,797 (GRCm39) missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119,328,682 (GRCm39) missense probably benign 0.39
R3722:Uggt2 UTSW 14 119,278,930 (GRCm39) missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119,295,084 (GRCm39) missense probably benign 0.13
R4015:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119,286,674 (GRCm39) missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119,256,970 (GRCm39) missense probably benign
R4642:Uggt2 UTSW 14 119,272,347 (GRCm39) missense probably benign 0.00
R4654:Uggt2 UTSW 14 119,269,670 (GRCm39) missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119,266,466 (GRCm39) splice site probably null
R4810:Uggt2 UTSW 14 119,250,933 (GRCm39) missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119,239,259 (GRCm39) missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4886:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4888:Uggt2 UTSW 14 119,286,665 (GRCm39) missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119,315,062 (GRCm39) critical splice donor site probably null
R4895:Uggt2 UTSW 14 119,256,298 (GRCm39) missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119,319,182 (GRCm39) missense probably benign 0.00
R5423:Uggt2 UTSW 14 119,256,898 (GRCm39) missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119,328,121 (GRCm39) missense probably benign 0.01
R5561:Uggt2 UTSW 14 119,278,939 (GRCm39) missense probably benign 0.02
R5607:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119,315,136 (GRCm39) missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119,280,138 (GRCm39) missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119,286,838 (GRCm39) missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6056:Uggt2 UTSW 14 119,273,381 (GRCm39) critical splice donor site probably null
R6289:Uggt2 UTSW 14 119,279,014 (GRCm39) missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119,294,976 (GRCm39) missense probably benign 0.01
R6515:Uggt2 UTSW 14 119,315,131 (GRCm39) missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119,308,293 (GRCm39) missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119,280,022 (GRCm39) missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119,263,847 (GRCm39) missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119,239,271 (GRCm39) missense probably benign 0.10
R7117:Uggt2 UTSW 14 119,251,938 (GRCm39) missense probably benign 0.25
R7337:Uggt2 UTSW 14 119,323,587 (GRCm39) missense probably benign 0.28
R7342:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119,326,681 (GRCm39) missense probably benign 0.12
R7625:Uggt2 UTSW 14 119,263,905 (GRCm39) missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119,312,759 (GRCm39) missense probably damaging 1.00
R7842:Uggt2 UTSW 14 119,235,516 (GRCm39) missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119,280,059 (GRCm39) missense probably benign 0.09
R7938:Uggt2 UTSW 14 119,296,519 (GRCm39) missense possibly damaging 0.68
R8050:Uggt2 UTSW 14 119,263,834 (GRCm39) missense probably damaging 0.98
R9007:Uggt2 UTSW 14 119,326,724 (GRCm39) missense probably damaging 1.00
R9080:Uggt2 UTSW 14 119,295,017 (GRCm39) missense probably benign 0.42
R9203:Uggt2 UTSW 14 119,294,975 (GRCm39) missense probably benign 0.08
R9215:Uggt2 UTSW 14 119,279,006 (GRCm39) missense probably damaging 1.00
R9324:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R9459:Uggt2 UTSW 14 119,286,595 (GRCm39) missense probably benign 0.02
R9647:Uggt2 UTSW 14 119,256,312 (GRCm39) missense probably damaging 1.00
R9781:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
Z1177:Uggt2 UTSW 14 119,244,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGGCCATCACTATTGTGTC -3'
(R):5'- AGACTCACTGCCTTTGTACTTG -3'

Sequencing Primer
(F):5'- GTGTCAACTACAACAGGATTGC -3'
(R):5'- TGGTGCAGGCATCGTGAAATTAG -3'
Posted On 2019-08-19