Mutagenetix > Incidental Mutations

Incidental Mutation 'R0555:Gba2'

45449

Institutional Source

Beutler Lab

Gene Symbol

Gba2

Ensembl Gene

ENSMUSG00000028467

Gene Name

glucosidase beta 2

Synonyms

bile acid

MMRRC Submission

038747-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0555 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43566928-43578873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43569927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 429 (G429C)

Ref Sequence

ENSEMBL: ENSMUSP00000030189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]

AlphaFold

Q69ZF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000030189
AA Change: G429C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: G429C

Domain	Start	End	E-Value	Type
Pfam:GBA2_N	142	446	9.4e-106	PFAM
Pfam:DUF608	512	879	1.3e-153	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102944

SMART Domains

Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

Domain	Start	End	E-Value	Type
low complexity region	54	83	N/A	INTRINSIC
low complexity region	132	147	N/A	INTRINSIC
BRLZ	158	222	2.03e-15	SMART
low complexity region	240	253	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128403

Predicted Effect

probably benign
Transcript: ENSMUST00000130443

SMART Domains

Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

Domain	Start	End	E-Value	Type
Pfam:GBA2_N	142	180	5.6e-13	PFAM
Pfam:GBA2_N	178	227	1.5e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138623

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139606

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144968

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148426

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159923

Predicted Effect

probably benign
Transcript: ENSMUST00000167751

SMART Domains

Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

Domain	Start	End	E-Value	Type
low complexity region	54	83	N/A	INTRINSIC
low complexity region	156	171	N/A	INTRINSIC
BRLZ	182	246	2.03e-15	SMART
low complexity region	264	277	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	T	A	9: 70,754,234	I363N	probably damaging	Het
Ahcyl2	T	C	6: 29,890,671		probably benign	Het
Asap1	A	G	15: 64,094,364	L941P	probably damaging	Het
Aurka	G	A	2: 172,367,147	R23C	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Casp8ap2	T	A	4: 32,640,381	H478Q	probably damaging	Het
Clcn4	C	T	7: 7,290,504	A418T	possibly damaging	Het
Cpxm2	A	T	7: 132,044,043	Y715*	probably null	Het
Csmd1	T	C	8: 16,185,273	M1179V	probably benign	Het
Ddx21	A	T	10: 62,587,528	F632I	probably damaging	Het
Dnaic1	C	A	4: 41,625,335	T433K	possibly damaging	Het
Dpyd	G	A	3: 119,431,542	G988D	probably damaging	Het
Dync1i2	AAAAGAAGAGGAAAGAAGAGGAAAG	AAAAGAAGAGGAAAG	2: 71,214,518		probably null	Het
Dync1li2	A	T	8: 104,420,665	S466T	probably benign	Het
Ears2	T	C	7: 122,048,444	T206A	probably benign	Het
Elmod1	A	T	9: 53,931,592		probably benign	Het
Eps8l3	C	A	3: 107,892,345	D590E	probably benign	Het
Etfdh	A	T	3: 79,605,805	H370Q	probably benign	Het
Fam83g	C	A	11: 61,707,663	A792E	probably benign	Het
Ffar3	G	T	7: 30,855,537	Y119*	probably null	Het
Fosb	G	T	7: 19,307,213	S118R	possibly damaging	Het
Foxn4	G	A	5: 114,263,114	L3F	probably damaging	Het
Foxo4	A	G	X: 101,255,178	K65E	probably damaging	Het
Frem2	A	G	3: 53,516,860	L3052P	probably damaging	Het
Fubp3	G	A	2: 31,608,137	R101H	probably damaging	Het
Gimap1	T	C	6: 48,741,429		probably benign	Het
Gm17657	A	T	17: 29,519,571	F74I	probably benign	Het
Gnas	A	G	2: 174,298,511	T158A	possibly damaging	Het
Gpc5	T	C	14: 115,552,328	V538A	probably damaging	Het
Greb1l	T	C	18: 10,458,781		probably benign	Het
H2-M10.5	G	A	17: 36,774,728	G260R	probably damaging	Het
Hbs1l	A	C	10: 21,349,323	Q412H	probably benign	Het
Hecw1	G	T	13: 14,236,941	T1058N	probably damaging	Het
Heph	A	T	X: 96,558,084	T1027S	probably damaging	Het
Hoga1	A	C	19: 42,046,075	E53A	possibly damaging	Het
Insrr	T	G	3: 87,814,437		probably benign	Het
Ipo11	A	T	13: 106,892,461	V328D	probably damaging	Het
Jakmip1	T	C	5: 37,118,873	V509A	probably damaging	Het
Jmjd1c	T	C	10: 67,225,789	V1307A	probably benign	Het
Kmt2a	T	A	9: 44,847,571	S1027C	probably damaging	Het
Kprp	G	C	3: 92,824,357	P462R	unknown	Het
Lman1l	T	C	9: 57,614,101	T193A	probably benign	Het
Lrit3	A	T	3: 129,791,296	V271D	probably damaging	Het
Map4	T	A	9: 109,979,103		probably benign	Het
Mark4	A	C	7: 19,448,673		probably benign	Het
Mfsd14b	A	G	13: 65,078,445	V142A	probably benign	Het
Mis18bp1	A	T	12: 65,161,453	I162N	possibly damaging	Het
Mrpl43	A	T	19: 45,005,952		probably benign	Het
Mrpl47	A	G	3: 32,736,693	F16S	probably benign	Het
Myh2	G	T	11: 67,178,967	G380C	probably damaging	Het
Myo15	T	C	11: 60,521,638	Y3284H	probably damaging	Het
Nectin2	A	G	7: 19,733,223		probably benign	Het
Neu3	A	G	7: 99,814,183	V111A	probably damaging	Het
Nol4l	T	C	2: 153,417,684		probably null	Het
Nphp3	C	A	9: 104,023,434	H510Q	probably damaging	Het
Nprl3	T	A	11: 32,233,118		probably null	Het
Olfr292	A	G	7: 86,695,308	N284S	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr598	T	C	7: 103,328,963	V159A	probably benign	Het
Olfr791	T	C	10: 129,526,896	I223T	possibly damaging	Het
Pex1	A	G	5: 3,606,130	E319G	possibly damaging	Het
Phtf1	C	A	3: 104,004,469	T709K	probably damaging	Het
Plek2	A	T	12: 78,892,172	L271Q	probably damaging	Het
Plekhg5	T	A	4: 152,107,469	C421*	probably null	Het
Polk	A	C	13: 96,484,179	C525W	probably damaging	Het
Ppfibp2	T	C	7: 107,729,174	S471P	probably damaging	Het
Prickle2	A	T	6: 92,458,565	F74L	probably benign	Het
Prl7d1	A	T	13: 27,712,055	V113D	probably benign	Het
Prr14	C	T	7: 127,472,095		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ret	A	G	6: 118,178,610	V375A	probably damaging	Het
Rora	T	C	9: 69,361,746	F41S	probably damaging	Het
Sall1	T	C	8: 89,031,758	T573A	probably benign	Het
Shb	A	G	4: 45,458,321	V281A	possibly damaging	Het
Slc25a26	A	T	6: 94,592,410		probably null	Het
Sltm	T	C	9: 70,586,081	F769L	probably damaging	Het
Snx9	T	A	17: 5,918,413	M328K	probably damaging	Het
Stk25	G	T	1: 93,624,591	Q356K	probably benign	Het
Svep1	T	A	4: 58,128,858	Y613F	possibly damaging	Het
Syne4	G	A	7: 30,316,744	A195T	probably damaging	Het
Tmem8	T	C	17: 26,117,114	L130S	probably benign	Het
Trcg1	C	T	9: 57,242,333	T396M	probably damaging	Het
Trim30b	A	G	7: 104,357,298	V117A	possibly damaging	Het
Trpc4	T	C	3: 54,302,090		probably benign	Het
Ttll4	A	G	1: 74,688,280	H827R	probably damaging	Het
Urgcp	T	C	11: 5,717,477	E287G	probably damaging	Het
Usp2	G	T	9: 44,092,784	L319F	probably damaging	Het
Vmn1r167	A	T	7: 23,505,087	V168D	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r61	A	T	7: 42,266,018	I130F	probably benign	Het
Vmn2r63	A	T	7: 42,928,528	Y195*	probably null	Het
Vmn2r81	T	C	10: 79,293,449	S725P	probably damaging	Het
Wnt10b	A	G	15: 98,772,937		probably benign	Het
Zcchc6	A	G	13: 59,800,317	V328A	probably benign	Het
Zfp292	T	C	4: 34,807,194	E1950G	probably damaging	Het
Zfyve16	A	G	13: 92,516,520		probably benign	Het

Other mutations in Gba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Gba2	APN	4	43568477	missense	probably damaging	1.00
IGL01577:Gba2	APN	4	43573753	nonsense	probably null
IGL02066:Gba2	APN	4	43570175	missense	probably benign	0.18
IGL02126:Gba2	APN	4	43567918	critical splice acceptor site	probably null
IGL02243:Gba2	APN	4	43568719	missense	probably benign	0.13
IGL02474:Gba2	APN	4	43568538	missense	possibly damaging	0.69
IGL02567:Gba2	APN	4	43567281	missense	probably benign
IGL02628:Gba2	APN	4	43568919	missense	probably benign	0.01
IGL02706:Gba2	APN	4	43567257	missense	probably benign	0.01
IGL02795:Gba2	APN	4	43578331	missense	probably damaging	1.00
R0389:Gba2	UTSW	4	43570832	missense	probably damaging	1.00
R0650:Gba2	UTSW	4	43570424	splice site	probably null
R1603:Gba2	UTSW	4	43567823	missense	probably damaging	1.00
R1628:Gba2	UTSW	4	43570118	missense	probably benign	0.00
R1664:Gba2	UTSW	4	43578080	missense	probably benign	0.01
R1686:Gba2	UTSW	4	43573869	splice site	probably benign
R1730:Gba2	UTSW	4	43578242	missense	probably benign	0.01
R2036:Gba2	UTSW	4	43568118	unclassified	probably benign
R2061:Gba2	UTSW	4	43574029	nonsense	probably null
R2259:Gba2	UTSW	4	43570107	missense	probably benign
R2847:Gba2	UTSW	4	43568000	splice site	probably null
R3026:Gba2	UTSW	4	43578308	missense	possibly damaging	0.95
R3617:Gba2	UTSW	4	43573803	missense	probably damaging	1.00
R4225:Gba2	UTSW	4	43569464	unclassified	probably benign
R4346:Gba2	UTSW	4	43571337	missense	probably benign	0.04
R4601:Gba2	UTSW	4	43573810	missense	probably damaging	1.00
R4611:Gba2	UTSW	4	43568092	missense	probably damaging	1.00
R4664:Gba2	UTSW	4	43568619	unclassified	probably benign
R4784:Gba2	UTSW	4	43568315	missense	probably damaging	1.00
R4785:Gba2	UTSW	4	43568315	missense	probably damaging	1.00
R5079:Gba2	UTSW	4	43568640	unclassified	probably benign
R5327:Gba2	UTSW	4	43574063	missense	probably damaging	1.00
R5746:Gba2	UTSW	4	43568465	splice site	probably null
R6052:Gba2	UTSW	4	43568330	missense	probably damaging	1.00
R6485:Gba2	UTSW	4	43574118	missense	probably damaging	1.00
R7073:Gba2	UTSW	4	43573753	missense	probably damaging	1.00
R7112:Gba2	UTSW	4	43568453	missense	probably benign	0.01
R7472:Gba2	UTSW	4	43568967	missense	probably benign	0.44
R8220:Gba2	UTSW	4	43568510	missense	probably damaging	1.00
R8315:Gba2	UTSW	4	43569937	frame shift	probably null
R8476:Gba2	UTSW	4	43569944	missense	probably damaging	0.98
R8477:Gba2	UTSW	4	43569944	missense	probably damaging	0.98
R8794:Gba2	UTSW	4	43568077	missense	probably damaging	0.98
R9087:Gba2	UTSW	4	43568304	missense	probably benign	0.09
R9193:Gba2	UTSW	4	43578112	missense	probably benign	0.26
RF007:Gba2	UTSW	4	43569894	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTACCAGGCAGGCAAGGTTC -3'
(R):5'- GCGTCTCTAGCAAGCTGTTACCTC -3'

Sequencing Primer
(F):5'- GCTTTATGAGCCTCCCAGGATAG -3'
(R):5'- TAGCAAGCTGTTACCTCGAAGC -3'

Posted On

2013-06-11