Incidental Mutation 'R6088:Myo5b'
ID486122
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 044245-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R6088 (G1)
Quality Score187.009
Status Validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74720898 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1196 (L1196Q)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074157
AA Change: L1196Q

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: L1196Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121875
AA Change: L1196Q

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: L1196Q

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146253
Predicted Effect probably benign
Transcript: ENSMUST00000177366
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,902,102 V360F probably damaging Het
Ankrd17 C T 5: 90,253,688 E1605K possibly damaging Het
Arid4a A G 12: 71,022,236 D54G probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Card6 A T 15: 5,105,019 V234E possibly damaging Het
Cd1d1 G T 3: 86,998,702 Q89K probably benign Het
Ciita G A 16: 10,511,931 R693K probably damaging Het
Cox7a2l G T 17: 83,503,972 L77I probably benign Het
Crybg2 A T 4: 134,075,790 probably null Het
Cts8 T C 13: 61,253,966 N39S probably benign Het
Def8 G T 8: 123,460,048 E456* probably null Het
Dld A G 12: 31,340,989 F153L probably benign Het
Elf1 C T 14: 79,567,261 T122I probably benign Het
Emilin2 T C 17: 71,255,124 N961S probably benign Het
Esp24 A G 17: 39,040,010 I34V probably benign Het
Fam129b T C 2: 32,923,123 V540A probably damaging Het
Fam184b C A 5: 45,584,012 K292N probably damaging Het
Gabrg3 T A 7: 56,985,078 N119I probably damaging Het
Gucy1b1 T C 3: 82,034,880 H524R probably damaging Het
Kcp A T 6: 29,502,632 S205T probably benign Het
Klb C T 5: 65,349,013 T201M probably benign Het
Lamp3 A T 16: 19,673,398 F365L probably damaging Het
Mad1l1 T A 5: 140,193,963 H390L probably benign Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Ndufb8 A G 19: 44,555,025 S70P probably benign Het
Neb T C 2: 52,209,342 D4832G probably damaging Het
Nr5a1 T C 2: 38,701,995 D322G probably benign Het
Olfr396-ps1 A T 11: 73,928,823 T273S probably benign Het
Olfr988 T A 2: 85,353,354 S191C probably damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Oxa1l T A 14: 54,367,694 probably null Het
Pafah2 A G 4: 134,413,381 I221V probably benign Het
Pibf1 T A 14: 99,179,358 F456I probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekhg2 C T 7: 28,361,013 V964I probably benign Het
Ppip5k1 C A 2: 121,337,463 V770L probably benign Het
Ppl A T 16: 5,104,988 L213Q possibly damaging Het
Ptprf G A 4: 118,210,755 T1785I possibly damaging Het
Pycr2 G A 1: 180,906,236 G131E probably damaging Het
Rbpj C T 5: 53,651,368 probably null Het
Rcc1 G T 4: 132,332,842 D430E probably benign Het
Rhbdf1 A G 11: 32,212,007 V525A possibly damaging Het
Samd7 G A 3: 30,756,483 M216I probably benign Het
Ska3 A T 14: 57,816,694 D266E probably benign Het
Slc1a7 G A 4: 108,012,444 V569M probably damaging Het
Slc26a1 C T 5: 108,674,006 E6K possibly damaging Het
Slc4a4 T A 5: 89,197,704 V741E probably benign Het
St6galnac3 C T 3: 153,206,715 G164S probably damaging Het
Tgs1 T A 4: 3,595,383 N517K probably benign Het
Tns4 A G 11: 99,073,720 S522P probably damaging Het
Trpm1 A T 7: 64,267,976 M355L probably damaging Het
Trpm8 G A 1: 88,306,678 probably benign Het
Uhrf1bp1 G A 17: 27,884,605 probably null Het
V1ra8 T C 6: 90,203,100 F95S probably damaging Het
Zfp521 A C 18: 13,846,109 S416A possibly damaging Het
Zfp574 T A 7: 25,080,339 V262E probably benign Het
Zfp740 T A 15: 102,208,808 I77N probably damaging Het
Zscan18 A T 7: 12,775,198 probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74731754 missense probably benign
BB017:Myo5b UTSW 18 74731754 missense probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
R7930:Myo5b UTSW 18 74731754 missense probably benign
R8013:Myo5b UTSW 18 74760899 nonsense probably null
R8271:Myo5b UTSW 18 74627190 missense probably damaging 1.00
R8312:Myo5b UTSW 18 74733962 missense probably damaging 1.00
R8383:Myo5b UTSW 18 74643978 missense probably benign 0.05
R8384:Myo5b UTSW 18 74742202 missense probably damaging 1.00
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Z1177:Myo5b UTSW 18 74617017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGGGGAATACACCTGTGGAG -3'
(R):5'- GTATTTTAACCCGAGCTGCTG -3'

Sequencing Primer
(F):5'- AGGGTGAGGTTGCCATCTC -3'
(R):5'- TAACCCGAGCTGCTGCAAGTAG -3'
Posted On2017-08-16