Incidental Mutation 'R6256:Ccdc7a'
ID506121
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Namecoiled-coil domain containing 7A
SynonymsCcdc7, 4930517G15Rik, 4930540C21Rik
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6256 (G1)
Quality Score196.009
Status Validated
Chromosome8
Chromosomal Location128734235-129065517 bp(-) (GRCm38)
Type of Mutationsplice site (73 bp from exon)
DNA Base Change (assembly) T to C at 128935593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149790 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000214889
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129026754 splice site probably benign
IGL01019:Ccdc7a APN 8 129061618 missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129026591 splice site probably benign
IGL01577:Ccdc7a APN 8 128988763 missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129026689 missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129058763 missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129061681 missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 128988766 nonsense probably null
R1957:Ccdc7a UTSW 8 128980135 missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 128980054 intron probably benign
R4981:Ccdc7a UTSW 8 128984983 missense probably benign 0.35
R5193:Ccdc7a UTSW 8 128988797 missense probably benign 0.02
R5273:Ccdc7a UTSW 8 129061609 frame shift probably null
R5486:Ccdc7a UTSW 8 128985403 missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 128980174 missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129058785 missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 128980096 splice site probably benign
R6273:Ccdc7a UTSW 8 128787338 missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 128855992 missense unknown
R6455:Ccdc7a UTSW 8 128832610 missense probably damaging 0.97
R6778:Ccdc7a UTSW 8 128821120 missense possibly damaging 0.66
R6882:Ccdc7a UTSW 8 128797328 intron probably benign
R6891:Ccdc7a UTSW 8 129026638 missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 128935681 missense unknown
R7028:Ccdc7a UTSW 8 128881594 missense unknown
R7046:Ccdc7a UTSW 8 129047619 missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 128892385 missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 128881152 missense possibly damaging 0.66
R7454:Ccdc7a UTSW 8 128944516 missense unknown
R7643:Ccdc7a UTSW 8 128889811 missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 128993052 missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 128892437 missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R7946:Ccdc7a UTSW 8 128917146 missense probably damaging 0.97
R7983:Ccdc7a UTSW 8 128881078 missense possibly damaging 0.66
R8032:Ccdc7a UTSW 8 128825383 missense unknown
R8108:Ccdc7a UTSW 8 128980153 missense unknown
R8345:Ccdc7a UTSW 8 128798764 missense probably benign 0.01
R8372:Ccdc7a UTSW 8 128821104 missense possibly damaging 0.82
R8379:Ccdc7a UTSW 8 128964936 missense probably benign 0.03
R8472:Ccdc7a UTSW 8 129027657 missense probably damaging 0.99
R8478:Ccdc7a UTSW 8 128761369 missense possibly damaging 0.66
R8536:Ccdc7a UTSW 8 128790120 missense possibly damaging 0.66
R8671:Ccdc7a UTSW 8 128920467 missense probably damaging 0.99
R8696:Ccdc7a UTSW 8 128988763 missense probably damaging 0.96
R8813:Ccdc7a UTSW 8 128823461 missense possibly damaging 0.83
RF008:Ccdc7a UTSW 8 128964953 missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129026663 missense probably benign 0.41
Z1177:Ccdc7a UTSW 8 128807924 missense possibly damaging 0.66
Z1190:Ccdc7a UTSW 8 128819895 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGGTGCCAGAGCTTGCATTTTAG -3'
(R):5'- TTATGTAGGTCCTTTGGAGATACC -3'

Sequencing Primer
(F):5'- CCAGAGCTTGCATTTTAGTTCTTTG -3'
(R):5'- CCAAGTGAAAGTTCAAATGAAGATG -3'
Posted On2018-02-28