Incidental Mutation 'R6256:Ccdc7a'
ID 506121
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Name coiled-coil domain containing 7A
Synonyms 4930540C21Rik, 4930517G15Rik, Ccdc7
MMRRC Submission 044373-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R6256 (G1)
Quality Score 196.009
Status Validated
Chromosome 8
Chromosomal Location 129460715-129791973 bp(-) (GRCm39)
Type of Mutation splice site (73 bp from exon)
DNA Base Change (assembly) T to C at 129662074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214889]
AlphaFold Q9D541
Predicted Effect probably null
Transcript: ENSMUST00000214889
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,205,272 (GRCm39) Q361L probably damaging Het
Abca7 A G 10: 79,838,456 (GRCm39) T577A probably damaging Het
Acad12 A T 5: 121,752,149 (GRCm39) V54E probably benign Het
Ago4 A G 4: 126,414,019 (GRCm39) Y91H probably damaging Het
Akr1b10 T C 6: 34,364,623 (GRCm39) V28A probably damaging Het
Ccdc33 T A 9: 58,009,201 (GRCm39) probably null Het
Ces1f A T 8: 93,992,422 (GRCm39) V343E probably damaging Het
Cftr T C 6: 18,274,660 (GRCm39) L896P probably damaging Het
Csmd3 G A 15: 47,533,125 (GRCm39) P2375S probably damaging Het
Dnajb14 C T 3: 137,614,124 (GRCm39) A345V probably damaging Het
Dnajb14 G C 3: 137,614,123 (GRCm39) A345P probably damaging Het
Dnase1 G A 16: 3,855,485 (GRCm39) R24K probably benign Het
Dnmbp C T 19: 43,840,720 (GRCm39) V560M probably damaging Het
Dop1b T A 16: 93,604,102 (GRCm39) I1981N possibly damaging Het
Eif3a A C 19: 60,759,464 (GRCm39) S770A possibly damaging Het
Fbxl7 A T 15: 26,553,088 (GRCm39) C60S probably benign Het
Fras1 A T 5: 96,881,702 (GRCm39) D2478V possibly damaging Het
Hrnr A G 3: 93,229,918 (GRCm39) D52G probably damaging Het
Jmjd1c T A 10: 67,056,187 (GRCm39) L823M probably damaging Het
Kdm1a G T 4: 136,295,911 (GRCm39) C172* probably null Het
Kdm6b C T 11: 69,297,555 (GRCm39) E295K probably damaging Het
Mepe A T 5: 104,484,940 (GRCm39) M27L probably benign Het
Mogat2 A T 7: 98,869,102 (GRCm39) H305Q probably damaging Het
Mst1r T A 9: 107,794,465 (GRCm39) Y1215N probably damaging Het
Muc5ac A T 7: 141,343,532 (GRCm39) H48L possibly damaging Het
Myo7b T C 18: 32,116,748 (GRCm39) D953G probably damaging Het
Ocel1 T C 8: 71,824,472 (GRCm39) probably benign Het
Pcdhb6 A G 18: 37,468,978 (GRCm39) D633G probably damaging Het
Ppm1l A G 3: 69,405,230 (GRCm39) I176V probably benign Het
Sall3 C T 18: 81,013,076 (GRCm39) R1120H possibly damaging Het
Sbf1 G A 15: 89,185,070 (GRCm39) P1018S probably benign Het
Setbp1 T C 18: 78,900,472 (GRCm39) Y1065C probably damaging Het
Slc25a2 T C 18: 37,770,776 (GRCm39) probably null Het
Slc4a2 C A 5: 24,640,888 (GRCm39) T729K probably damaging Het
Sptlc2 T C 12: 87,402,305 (GRCm39) E207G probably damaging Het
Sult6b1 A T 17: 79,214,343 (GRCm39) F27I probably benign Het
Syf2 A T 4: 134,661,889 (GRCm39) K84N probably damaging Het
Tmem209 A T 6: 30,497,166 (GRCm39) N183K probably benign Het
Tmem232 G T 17: 65,785,397 (GRCm39) Q188K possibly damaging Het
Tomm70a A T 16: 56,973,055 (GRCm39) T598S probably benign Het
Ttll13 A G 7: 79,908,052 (GRCm39) T556A probably benign Het
Vmn2r120 A T 17: 57,831,700 (GRCm39) L363* probably null Het
Xpo6 G T 7: 125,707,791 (GRCm39) Q872K probably damaging Het
Xrra1 A C 7: 99,563,671 (GRCm39) S553R probably damaging Het
Zfy1 A T Y: 738,765 (GRCm39) V147E unknown Homo
Zfy2 T C Y: 2,116,267 (GRCm39) I258V probably benign Homo
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129,753,235 (GRCm39) splice site probably benign
IGL01019:Ccdc7a APN 8 129,788,099 (GRCm39) missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129,753,072 (GRCm39) splice site probably benign
IGL01577:Ccdc7a APN 8 129,715,244 (GRCm39) missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129,753,170 (GRCm39) missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129,785,244 (GRCm39) missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129,788,162 (GRCm39) missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 129,715,247 (GRCm39) nonsense probably null
R1957:Ccdc7a UTSW 8 129,706,616 (GRCm39) missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 129,706,535 (GRCm39) intron probably benign
R4981:Ccdc7a UTSW 8 129,711,464 (GRCm39) missense probably benign 0.35
R5193:Ccdc7a UTSW 8 129,715,278 (GRCm39) missense probably benign 0.02
R5273:Ccdc7a UTSW 8 129,788,090 (GRCm39) frame shift probably null
R5486:Ccdc7a UTSW 8 129,711,884 (GRCm39) missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 129,706,655 (GRCm39) missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129,785,266 (GRCm39) missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 129,706,577 (GRCm39) splice site probably benign
R6273:Ccdc7a UTSW 8 129,513,819 (GRCm39) missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 129,582,473 (GRCm39) missense unknown
R6455:Ccdc7a UTSW 8 129,559,091 (GRCm39) missense probably damaging 0.97
R6778:Ccdc7a UTSW 8 129,547,601 (GRCm39) missense possibly damaging 0.66
R6882:Ccdc7a UTSW 8 129,523,809 (GRCm39) intron probably benign
R6891:Ccdc7a UTSW 8 129,753,119 (GRCm39) missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 129,662,162 (GRCm39) missense unknown
R7028:Ccdc7a UTSW 8 129,608,075 (GRCm39) missense unknown
R7046:Ccdc7a UTSW 8 129,774,100 (GRCm39) missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 129,618,866 (GRCm39) missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 129,607,633 (GRCm39) missense possibly damaging 0.66
R7454:Ccdc7a UTSW 8 129,670,997 (GRCm39) missense unknown
R7643:Ccdc7a UTSW 8 129,616,292 (GRCm39) missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 129,719,533 (GRCm39) missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 129,618,918 (GRCm39) missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 129,562,654 (GRCm39) missense possibly damaging 0.46
R7946:Ccdc7a UTSW 8 129,643,627 (GRCm39) missense probably damaging 0.97
R7983:Ccdc7a UTSW 8 129,607,559 (GRCm39) missense possibly damaging 0.66
R8032:Ccdc7a UTSW 8 129,551,864 (GRCm39) missense unknown
R8108:Ccdc7a UTSW 8 129,706,634 (GRCm39) missense unknown
R8345:Ccdc7a UTSW 8 129,525,245 (GRCm39) missense probably benign 0.01
R8372:Ccdc7a UTSW 8 129,547,585 (GRCm39) missense possibly damaging 0.82
R8379:Ccdc7a UTSW 8 129,691,417 (GRCm39) missense probably benign 0.03
R8472:Ccdc7a UTSW 8 129,754,138 (GRCm39) missense probably damaging 0.99
R8478:Ccdc7a UTSW 8 129,487,850 (GRCm39) missense possibly damaging 0.66
R8536:Ccdc7a UTSW 8 129,516,601 (GRCm39) missense possibly damaging 0.66
R8671:Ccdc7a UTSW 8 129,646,948 (GRCm39) missense probably damaging 0.99
R8696:Ccdc7a UTSW 8 129,715,244 (GRCm39) missense probably damaging 0.96
R8813:Ccdc7a UTSW 8 129,549,942 (GRCm39) missense possibly damaging 0.83
R8859:Ccdc7a UTSW 8 129,788,113 (GRCm39) missense probably benign 0.44
R9208:Ccdc7a UTSW 8 129,472,482 (GRCm39) missense possibly damaging 0.66
R9222:Ccdc7a UTSW 8 129,525,610 (GRCm39) missense unknown
R9262:Ccdc7a UTSW 8 129,486,277 (GRCm39) missense possibly damaging 0.66
R9299:Ccdc7a UTSW 8 129,616,319 (GRCm39) missense probably benign 0.27
R9337:Ccdc7a UTSW 8 129,616,319 (GRCm39) missense probably benign 0.27
R9357:Ccdc7a UTSW 8 129,671,136 (GRCm39) critical splice acceptor site probably null
R9516:Ccdc7a UTSW 8 129,555,774 (GRCm39) missense unknown
R9579:Ccdc7a UTSW 8 129,774,134 (GRCm39) nonsense probably null
R9672:Ccdc7a UTSW 8 129,671,016 (GRCm39) missense unknown
R9777:Ccdc7a UTSW 8 129,618,860 (GRCm39) missense possibly damaging 0.90
RF008:Ccdc7a UTSW 8 129,691,434 (GRCm39) missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129,753,144 (GRCm39) missense probably benign 0.41
Z1177:Ccdc7a UTSW 8 129,534,405 (GRCm39) missense possibly damaging 0.66
Z1190:Ccdc7a UTSW 8 129,546,376 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGGTGCCAGAGCTTGCATTTTAG -3'
(R):5'- TTATGTAGGTCCTTTGGAGATACC -3'

Sequencing Primer
(F):5'- CCAGAGCTTGCATTTTAGTTCTTTG -3'
(R):5'- CCAAGTGAAAGTTCAAATGAAGATG -3'
Posted On 2018-02-28