Mutagenetix > Incidental Mutation

Incidental Mutation 'R1695:Vps13b'

192167

Institutional Source

Beutler Lab

Gene Symbol

Vps13b

Ensembl Gene

ENSMUSG00000037646

Gene Name

vacuolar protein sorting 13B

Synonyms

2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik

MMRRC Submission

039728-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35371160-35931229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35576521 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1025 (V1025A)

Ref Sequence

ENSEMBL: ENSMUSP00000045490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048646]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048646
AA Change: V1025A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: V1025A

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	120	1e-29	PFAM
low complexity region	128	137	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1007	1018	N/A	INTRINSIC
low complexity region	1876	1883	N/A	INTRINSIC
low complexity region	2042	2054	N/A	INTRINSIC
low complexity region	2414	2423	N/A	INTRINSIC
Pfam:SHR-BD	2601	2700	8.4e-10	PFAM
low complexity region	2954	2964	N/A	INTRINSIC
Pfam:VPS13_C	3539	3706	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226579

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610301B20Rik	T	A	4: 10,874,644	D10E	probably damaging	Het
Adam1b	T	A	5: 121,500,907	T692S	probably benign	Het
Adgrf3	T	A	5: 30,203,555	N75I	probably benign	Het
Adgrg5	A	G	8: 94,937,745	M328V	probably damaging	Het
Adk	A	G	14: 21,381,600	D286G	probably benign	Het
Ankrd28	T	A	14: 31,707,244	D917V	probably damaging	Het
Appl2	C	T	10: 83,621,582	D141N	probably damaging	Het
Arfgef2	T	C	2: 166,864,712	V952A	probably damaging	Het
Arpc2	T	A	1: 74,248,232	H70Q	probably damaging	Het
Bpifa5	T	C	2: 154,167,660	L261P	probably damaging	Het
Brca1	G	T	11: 101,524,455	T951K	probably damaging	Het
Ccdc189	A	G	7: 127,587,573		probably null	Het
Ccdc73	A	T	2: 104,992,105	S800C	probably damaging	Het
Cdh15	C	G	8: 122,862,016	D276E	probably benign	Het
Cfh	T	C	1: 140,102,837	I551V	probably damaging	Het
Chd7	T	A	4: 8,833,960	L1238Q	probably damaging	Het
Chd9	T	G	8: 91,001,782	F1275L	probably damaging	Het
Chrnb3	A	G	8: 27,393,700	Y155C	probably damaging	Het
Cltc	C	A	11: 86,701,060		probably null	Het
Ctsll3	T	A	13: 60,800,977	N55Y	probably damaging	Het
Cysltr2	T	C	14: 73,029,881	M130V	probably benign	Het
Daglb	T	C	5: 143,494,606	M455T	probably benign	Het
Dbn1	A	G	13: 55,476,708	S343P	probably benign	Het
Dnah2	T	A	11: 69,514,691	D665V	possibly damaging	Het
Dusp6	T	A	10: 99,263,693	M1K	probably null	Het
Eif3m	T	C	2: 105,016,953	E12G	probably damaging	Het
Epha2	T	C	4: 141,306,517	V29A	possibly damaging	Het
Fam160b1	T	C	19: 57,379,171	W337R	probably damaging	Het
Farp2	T	A	1: 93,560,325	N91K	probably damaging	Het
Ferd3l	C	A	12: 33,928,972	S161R	probably benign	Het
Fgd2	A	T	17: 29,368,245	D315V	possibly damaging	Het
Fstl4	T	A	11: 53,165,878		probably null	Het
Grm5	A	G	7: 88,036,103	D476G	possibly damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdlbp	A	G	1: 93,437,200	L115P	probably damaging	Het
Hk2	T	A	6: 82,744,951	N136Y	probably damaging	Het
Hs2st1	G	T	3: 144,434,654	A302E	probably benign	Het
Htr7	T	C	19: 35,969,736	N293D	probably benign	Het
Ikbkb	T	A	8: 22,673,480	E271D	probably benign	Het
Il5ra	A	T	6: 106,738,374	Y166*	probably null	Het
Il9r	T	A	11: 32,193,227	H244L	probably benign	Het
Itih4	T	C	14: 30,891,499		probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Large1	A	T	8: 72,818,082	D689E	probably damaging	Het
Limk2	A	G	11: 3,353,275		probably null	Het
Med15	A	G	16: 17,722,780	F34S	probably damaging	Het
Mprip	C	T	11: 59,752,531	T505I	probably damaging	Het
Mtor	T	A	4: 148,538,907	N2071K	probably benign	Het
Muc16	A	G	9: 18,497,433	L2522P	probably damaging	Het
Myd88	A	T	9: 119,337,842		probably null	Het
Myo7a	A	C	7: 98,092,496	F484V	possibly damaging	Het
Nme1	A	C	11: 93,960,767	L81R	probably benign	Het
Ntn4	T	A	10: 93,733,602		probably null	Het
Olfr1180	T	C	2: 88,412,100	D186G	probably damaging	Het
Olfr1383	T	C	11: 49,524,335	V204A	probably benign	Het
Olfr630	A	T	7: 103,754,924	Y220*	probably null	Het
Otogl	T	G	10: 107,814,017	N1159T	probably damaging	Het
Pabpc6	G	A	17: 9,668,074	T516I	probably benign	Het
Pcdh1	C	T	18: 38,202,868	R238H	probably damaging	Het
Pex5l	T	A	3: 32,954,382	N151I	probably benign	Het
Plekha7	T	C	7: 116,128,685	N980S	probably damaging	Het
Reg4	C	T	3: 98,236,361	T157I	probably benign	Het
Rev3l	G	T	10: 39,824,615	E1703*	probably null	Het
Rev3l	A	T	10: 39,824,616	E1703V	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Saal1	T	C	7: 46,692,916	K368E	probably damaging	Het
Scn9a	C	T	2: 66,504,876	W1245*	probably null	Het
Slc38a11	T	A	2: 65,316,971	L387F	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sptb	C	A	12: 76,620,867	V819L	probably benign	Het
Sptbn1	T	C	11: 30,136,124	T1195A	probably benign	Het
Ssna1	C	A	2: 25,272,012	V57F	possibly damaging	Het
Stk32a	G	T	18: 43,313,420	E312*	probably null	Het
Synpo	A	G	18: 60,603,387	F496L	probably benign	Het
Syt15	C	T	14: 34,222,901	T135M	probably benign	Het
Tm9sf4	A	G	2: 153,190,912	E246G	probably benign	Het
Trim44	T	C	2: 102,357,485	M308V	possibly damaging	Het
Unc119b	T	A	5: 115,134,826	K29*	probably null	Het
Vim	T	A	2: 13,580,110	D367E	probably benign	Het
Virma	T	A	4: 11,494,814	N38K	probably damaging	Het
Vmn1r228	A	T	17: 20,776,298	D319E	possibly damaging	Het
Vmn2r32	T	A	7: 7,463,992	I846F	probably benign	Het
Vps13c	G	T	9: 67,972,075	E566*	probably null	Het

Other mutations in Vps13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vps13b	APN	15	35926226	missense	possibly damaging	0.52
IGL00513:Vps13b	APN	15	35793884	missense	probably damaging	1.00
IGL00516:Vps13b	APN	15	35640557	missense	probably damaging	1.00
IGL00640:Vps13b	APN	15	35417577	missense	probably benign
IGL00753:Vps13b	APN	15	35372031	missense	probably damaging	0.99
IGL00784:Vps13b	APN	15	35846900	missense	probably damaging	1.00
IGL01138:Vps13b	APN	15	35446770	splice site	probably benign
IGL01349:Vps13b	APN	15	35793945	missense	probably benign	0.00
IGL01403:Vps13b	APN	15	35709479	missense	probably benign	0.00
IGL01535:Vps13b	APN	15	35454957	missense	possibly damaging	0.67
IGL01571:Vps13b	APN	15	35877489	splice site	probably benign
IGL01642:Vps13b	APN	15	35792072	missense	probably benign	0.43
IGL01658:Vps13b	APN	15	35671333	missense	probably damaging	0.99
IGL01759:Vps13b	APN	15	35878789	missense	probably damaging	1.00
IGL01763:Vps13b	APN	15	35709799	missense	possibly damaging	0.72
IGL01906:Vps13b	APN	15	35639847	splice site	probably benign
IGL01982:Vps13b	APN	15	35438904	nonsense	probably null
IGL01997:Vps13b	APN	15	35709224	missense	probably damaging	1.00
IGL02041:Vps13b	APN	15	35423245	missense	probably damaging	0.98
IGL02073:Vps13b	APN	15	35875586	missense	possibly damaging	0.52
IGL02077:Vps13b	APN	15	35910613	missense	possibly damaging	0.68
IGL02141:Vps13b	APN	15	35572081	missense	probably benign	0.09
IGL02146:Vps13b	APN	15	35646333	missense	probably benign	0.36
IGL02197:Vps13b	APN	15	35930056	missense	probably benign	0.02
IGL02311:Vps13b	APN	15	35709514	missense	probably benign	0.08
IGL02466:Vps13b	APN	15	35770741	missense	possibly damaging	0.86
IGL02506:Vps13b	APN	15	35917162	missense	probably damaging	1.00
IGL02550:Vps13b	APN	15	35572096	missense	probably benign
IGL02553:Vps13b	APN	15	35646301	missense	probably benign	0.00
IGL02674:Vps13b	APN	15	35639958	missense	probably benign	0.41
IGL02690:Vps13b	APN	15	35917142	missense	probably damaging	1.00
IGL02731:Vps13b	APN	15	35917128	missense	probably benign	0.00
IGL02739:Vps13b	APN	15	35879900	missense	probably damaging	1.00
IGL02868:Vps13b	APN	15	35884519	missense	probably benign	0.03
IGL03081:Vps13b	APN	15	35875820	missense	probably damaging	0.97
IGL03178:Vps13b	APN	15	35869300	missense	probably damaging	1.00
IGL03343:Vps13b	APN	15	35917170	missense	possibly damaging	0.76
IGL03407:Vps13b	APN	15	35639866	missense	possibly damaging	0.95
IGL03410:Vps13b	APN	15	35910340	missense	probably benign
omlette	UTSW	15	35671400	missense	probably benign	0.13
swiss	UTSW	15	35709673	missense	possibly damaging	0.80
FR4449:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4548:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4737:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4976:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
LCD18:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
PIT4531001:Vps13b	UTSW	15	35878825	missense	probably damaging	1.00
PIT4581001:Vps13b	UTSW	15	35534263	missense	probably damaging	1.00
PIT4618001:Vps13b	UTSW	15	35709240	missense	probably damaging	1.00
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0108:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0116:Vps13b	UTSW	15	35423155	missense	probably damaging	0.99
R0123:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0124:Vps13b	UTSW	15	35576528	critical splice donor site	probably null
R0134:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0137:Vps13b	UTSW	15	35926219	missense	probably benign	0.06
R0195:Vps13b	UTSW	15	35471899	missense	probably benign	0.00
R0225:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0320:Vps13b	UTSW	15	35674828	missense	probably damaging	0.98
R0333:Vps13b	UTSW	15	35879803	missense	probably damaging	1.00
R0336:Vps13b	UTSW	15	35455133	nonsense	probably null
R0463:Vps13b	UTSW	15	35597409	missense	probably damaging	0.98
R0466:Vps13b	UTSW	15	35445602	nonsense	probably null
R0472:Vps13b	UTSW	15	35417633	critical splice donor site	probably null
R0523:Vps13b	UTSW	15	35472050	missense	probably benign	0.20
R0602:Vps13b	UTSW	15	35422368	missense	probably damaging	1.00
R0612:Vps13b	UTSW	15	35623657	missense	probably benign	0.12
R0627:Vps13b	UTSW	15	35371999	nonsense	probably null
R0679:Vps13b	UTSW	15	35709703	missense	possibly damaging	0.73
R0742:Vps13b	UTSW	15	35794361	missense	probably benign	0.22
R1053:Vps13b	UTSW	15	35652363	missense	probably damaging	1.00
R1355:Vps13b	UTSW	15	35422454	missense	probably damaging	1.00
R1386:Vps13b	UTSW	15	35923312	missense	probably damaging	0.99
R1403:Vps13b	UTSW	15	35709122	splice site	probably benign
R1453:Vps13b	UTSW	15	35422444	missense	probably damaging	0.97
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1511:Vps13b	UTSW	15	35839975	missense	probably damaging	0.99
R1511:Vps13b	UTSW	15	35841573	missense	probably benign	0.00
R1513:Vps13b	UTSW	15	35438730	nonsense	probably null
R1536:Vps13b	UTSW	15	35875566	missense	probably damaging	0.98
R1537:Vps13b	UTSW	15	35792181	missense	possibly damaging	0.62
R1558:Vps13b	UTSW	15	35534319	missense	probably damaging	1.00
R1601:Vps13b	UTSW	15	35642436	missense	probably benign	0.11
R1653:Vps13b	UTSW	15	35607272	nonsense	probably null
R1760:Vps13b	UTSW	15	35884619	missense	possibly damaging	0.54
R1785:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1786:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1803:Vps13b	UTSW	15	35430205	nonsense	probably null
R1804:Vps13b	UTSW	15	35917137	missense	probably damaging	1.00
R1808:Vps13b	UTSW	15	35792059	missense	probably benign	0.00
R1817:Vps13b	UTSW	15	35910642	missense	possibly damaging	0.86
R1818:Vps13b	UTSW	15	35877577	missense	probably benign	0.00
R1836:Vps13b	UTSW	15	35910232	missense	probably damaging	0.99
R1850:Vps13b	UTSW	15	35674959	splice site	probably benign
R1884:Vps13b	UTSW	15	35430291	splice site	probably benign
R1938:Vps13b	UTSW	15	35709507	missense	probably damaging	1.00
R1955:Vps13b	UTSW	15	35925408	critical splice donor site	probably null
R1956:Vps13b	UTSW	15	35869407	missense	probably damaging	1.00
R1958:Vps13b	UTSW	15	35878689	missense	probably damaging	0.99
R2013:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2014:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2015:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2038:Vps13b	UTSW	15	35884741	missense	probably damaging	1.00
R2058:Vps13b	UTSW	15	35841447	missense	probably damaging	1.00
R2082:Vps13b	UTSW	15	35910746	missense	possibly damaging	0.70
R2087:Vps13b	UTSW	15	35597493	missense	probably damaging	0.99
R2124:Vps13b	UTSW	15	35646080	missense	probably benign	0.08
R2130:Vps13b	UTSW	15	35671400	missense	probably benign	0.13
R2168:Vps13b	UTSW	15	35792188	missense	probably damaging	1.00
R2168:Vps13b	UTSW	15	35792189	missense	probably damaging	1.00
R2171:Vps13b	UTSW	15	35887197	missense	probably benign	0.44
R2221:Vps13b	UTSW	15	35884597	missense	probably benign
R2263:Vps13b	UTSW	15	35646181	missense	probably benign	0.02
R2289:Vps13b	UTSW	15	35572105	missense	probably damaging	1.00
R2316:Vps13b	UTSW	15	35674899	nonsense	probably null
R2351:Vps13b	UTSW	15	35869311	missense	probably damaging	1.00
R2512:Vps13b	UTSW	15	35884555	missense	probably benign	0.35
R3054:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3055:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3196:Vps13b	UTSW	15	35869395	missense	probably damaging	1.00
R3236:Vps13b	UTSW	15	35910304	missense	probably benign	0.40
R3404:Vps13b	UTSW	15	35926054	missense	probably damaging	1.00
R3722:Vps13b	UTSW	15	35671382	missense	probably damaging	0.99
R4077:Vps13b	UTSW	15	35455128	missense	probably damaging	0.99
R4153:Vps13b	UTSW	15	35792027	splice site	probably null
R4224:Vps13b	UTSW	15	35876419	missense	probably damaging	0.99
R4408:Vps13b	UTSW	15	35709294	missense	probably damaging	0.98
R4431:Vps13b	UTSW	15	35770753	missense	probably damaging	1.00
R4449:Vps13b	UTSW	15	35876793	missense	possibly damaging	0.86
R4508:Vps13b	UTSW	15	35709673	missense	possibly damaging	0.80
R4631:Vps13b	UTSW	15	35646132	missense	possibly damaging	0.95
R4655:Vps13b	UTSW	15	35770689	missense	probably benign
R4666:Vps13b	UTSW	15	35640544	missense	probably benign	0.13
R4684:Vps13b	UTSW	15	35646178	missense	probably damaging	0.98
R4684:Vps13b	UTSW	15	35841341	missense	probably benign
R4684:Vps13b	UTSW	15	35879821	missense	probably benign
R4721:Vps13b	UTSW	15	35910718	nonsense	probably null
R4771:Vps13b	UTSW	15	35910800	missense	probably damaging	1.00
R4830:Vps13b	UTSW	15	35452224	missense	possibly damaging	0.94
R4835:Vps13b	UTSW	15	35869372	missense	probably damaging	1.00
R4835:Vps13b	UTSW	15	35910293	missense	probably benign
R4857:Vps13b	UTSW	15	35456654	missense	probably benign	0.01
R4891:Vps13b	UTSW	15	35640515	splice site	probably null
R5095:Vps13b	UTSW	15	35923202	missense	probably damaging	1.00
R5110:Vps13b	UTSW	15	35770809	missense	probably damaging	0.99
R5147:Vps13b	UTSW	15	35456678	missense	probably benign	0.32
R5153:Vps13b	UTSW	15	35422453	missense	probably damaging	0.99
R5257:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5258:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5296:Vps13b	UTSW	15	35876413	missense	probably damaging	1.00
R5386:Vps13b	UTSW	15	35640528	critical splice acceptor site	probably null
R5396:Vps13b	UTSW	15	35886948	missense	probably damaging	0.99
R5412:Vps13b	UTSW	15	35533385	missense	probably damaging	1.00
R5488:Vps13b	UTSW	15	35770542	missense	probably benign
R5489:Vps13b	UTSW	15	35770542	missense	probably benign
R5503:Vps13b	UTSW	15	35452166	missense	probably damaging	0.97
R5575:Vps13b	UTSW	15	35929919	missense	probably damaging	1.00
R5781:Vps13b	UTSW	15	35794035	missense	probably damaging	0.97
R5872:Vps13b	UTSW	15	35869351	missense	possibly damaging	0.56
R5876:Vps13b	UTSW	15	35917061	missense	probably damaging	0.99
R5994:Vps13b	UTSW	15	35875772	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6045:Vps13b	UTSW	15	35671316	missense	probably damaging	0.99
R6143:Vps13b	UTSW	15	35668738	missense	probably damaging	0.99
R6147:Vps13b	UTSW	15	35930031	missense	probably benign	0.16
R6218:Vps13b	UTSW	15	35770464	missense	probably benign	0.00
R6447:Vps13b	UTSW	15	35572126	missense	probably benign	0.02
R6555:Vps13b	UTSW	15	35846847	missense	probably damaging	1.00
R6578:Vps13b	UTSW	15	35446101	missense	probably damaging	0.99
R6640:Vps13b	UTSW	15	35617696	missense	possibly damaging	0.93
R6645:Vps13b	UTSW	15	35910305	missense	probably benign	0.25
R6711:Vps13b	UTSW	15	35887249	missense	probably damaging	1.00
R6727:Vps13b	UTSW	15	35770683	missense	probably benign	0.19
R6737:Vps13b	UTSW	15	35910611	missense	probably damaging	1.00
R6844:Vps13b	UTSW	15	35877590	missense	probably benign	0.06
R6849:Vps13b	UTSW	15	35905309	missense	probably damaging	1.00
R6861:Vps13b	UTSW	15	35576395	missense	probably damaging	0.99
R6938:Vps13b	UTSW	15	35423198	missense	probably damaging	0.99
R6943:Vps13b	UTSW	15	35448689	missense	possibly damaging	0.95
R6989:Vps13b	UTSW	15	35448581	missense	probably benign	0.02
R7092:Vps13b	UTSW	15	35640634	missense	probably damaging	1.00
R7232:Vps13b	UTSW	15	35877557	missense	probably damaging	1.00
R7307:Vps13b	UTSW	15	35841545	missense	probably benign
R7400:Vps13b	UTSW	15	35378900	missense	probably damaging	1.00
R7414:Vps13b	UTSW	15	35910827	missense	probably damaging	1.00
R7497:Vps13b	UTSW	15	35876697	missense	probably benign	0.38
R7500:Vps13b	UTSW	15	35910524	missense	possibly damaging	0.74
R7603:Vps13b	UTSW	15	35576439	missense	probably damaging	0.98
R7605:Vps13b	UTSW	15	35770646	missense	probably damaging	0.97
R7849:Vps13b	UTSW	15	35423232	missense	probably damaging	0.99
R7984:Vps13b	UTSW	15	35879913	missense	probably benign
R8094:Vps13b	UTSW	15	35668906	critical splice donor site	probably null
R8097:Vps13b	UTSW	15	35709346	missense	probably benign	0.38
R8131:Vps13b	UTSW	15	35372109	critical splice donor site	probably null
R8139:Vps13b	UTSW	15	35607272	nonsense	probably null
R8174:Vps13b	UTSW	15	35709310	nonsense	probably null
R8225:Vps13b	UTSW	15	35794382	missense	probably damaging	0.99
R8239:Vps13b	UTSW	15	35597404	missense	probably damaging	1.00
R8244:Vps13b	UTSW	15	35917203	missense	probably damaging	1.00
R8303:Vps13b	UTSW	15	35639917	missense	probably damaging	1.00
R8311:Vps13b	UTSW	15	35886954	missense	probably benign	0.37
R8443:Vps13b	UTSW	15	35455100	missense	probably benign
R8494:Vps13b	UTSW	15	35422448	missense	probably damaging	0.99
R8499:Vps13b	UTSW	15	35841320	missense	probably damaging	1.00
R8506:Vps13b	UTSW	15	35446745	missense	probably benign	0.31
R8559:Vps13b	UTSW	15	35876642	missense	probably damaging	1.00
R8686:Vps13b	UTSW	15	35925389	missense	probably damaging	0.99
R8782:Vps13b	UTSW	15	35422337	missense	possibly damaging	0.93
R8806:Vps13b	UTSW	15	35472066	critical splice donor site	probably benign
R8824:Vps13b	UTSW	15	35533299	missense	probably damaging	0.99
R9024:Vps13b	UTSW	15	35923324	missense	probably damaging	0.97
R9038:Vps13b	UTSW	15	35875785	missense	possibly damaging	0.70
R9054:Vps13b	UTSW	15	35422391	missense	probably damaging	1.00
R9091:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9129:Vps13b	UTSW	15	35448647	missense	probably damaging	1.00
R9214:Vps13b	UTSW	15	35623746	missense	probably damaging	0.99
R9237:Vps13b	UTSW	15	35841333	missense	probably damaging	1.00
R9256:Vps13b	UTSW	15	35623779	missense	possibly damaging	0.95
R9270:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9279:Vps13b	UTSW	15	35572144	missense	probably damaging	0.97
R9291:Vps13b	UTSW	15	35846913	missense	probably damaging	1.00
R9342:Vps13b	UTSW	15	35455054	missense	possibly damaging	0.94
R9404:Vps13b	UTSW	15	35876419	missense	probably damaging	1.00
R9488:Vps13b	UTSW	15	35447734	missense	possibly damaging	0.77
R9509:Vps13b	UTSW	15	35841311	missense	possibly damaging	0.79
R9610:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9611:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9658:Vps13b	UTSW	15	35623628	missense	probably benign	0.00
R9674:Vps13b	UTSW	15	35607234	missense	probably damaging	0.98
R9696:Vps13b	UTSW	15	35674887	missense	possibly damaging	0.56
R9767:Vps13b	UTSW	15	35910257	missense	probably damaging	1.00
R9797:Vps13b	UTSW	15	35674876	missense	probably damaging	1.00
RF020:Vps13b	UTSW	15	35925406	missense	probably null	1.00
X0026:Vps13b	UTSW	15	35910646	missense	probably damaging	1.00
X0028:Vps13b	UTSW	15	35709431	missense	probably benign	0.00
Z1177:Vps13b	UTSW	15	35668885	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTTTATTGCCTCACGAAGATGGGAA -3'
(R):5'- ACATCTGAGGGTTCTAAAGCTGGGAA -3'

Sequencing Primer
(F):5'- TTCTTTCAGCAGCCTGTGGT -3'
(R):5'- TTCTAAAGCTGGGAAGAACTAAAGAC -3'

Posted On

2014-05-14