Incidental Mutation 'R6360:Mphosph10'
ID513069
Institutional Source Beutler Lab
Gene Symbol Mphosph10
Ensembl Gene ENSMUSG00000030521
Gene NameM-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6360 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64376527-64392268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64389955 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 89 (Q89R)
Ref Sequence ENSEMBL: ENSMUSP00000032735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000037205] [ENSMUST00000206194] [ENSMUST00000206882]
Predicted Effect probably benign
Transcript: ENSMUST00000032735
AA Change: Q89R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521
AA Change: Q89R

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037205
SMART Domains Protein: ENSMUSP00000047855
Gene: ENSMUSG00000033429

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Glyoxalase 49 175 2.7e-14 PFAM
Pfam:Glyoxalase_3 50 166 5.1e-9 PFAM
Pfam:Glyoxalase_4 51 162 1.2e-20 PFAM
Pfam:Glyoxalase_2 55 175 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206138
Predicted Effect probably benign
Transcript: ENSMUST00000206194
Predicted Effect probably benign
Transcript: ENSMUST00000206882
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap10 G A 8: 77,259,202 Q657* probably null Het
Car15 T C 16: 17,838,066 T560A probably benign Het
Cass4 C T 2: 172,432,611 H769Y probably damaging Het
Cdh6 A G 15: 13,041,460 I506T possibly damaging Het
Clstn3 G T 6: 124,438,429 R659S possibly damaging Het
Cntnap5b C T 1: 100,431,736 R695* probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dab2ip A G 2: 35,710,266 H355R probably benign Het
Dennd2a C T 6: 39,493,142 A539T probably benign Het
Dnajc18 T C 18: 35,686,709 E173G probably damaging Het
Dock7 T C 4: 98,969,662 I1472V probably benign Het
Esco1 A T 18: 10,574,931 F714I probably damaging Het
Fam107a T G 14: 8,299,619 H73P probably damaging Het
Fam46b T C 4: 133,486,756 F313L probably damaging Het
Flg A G 3: 93,290,601 probably benign Het
Fyn C A 10: 39,526,883 T217K possibly damaging Het
Gbp9 T C 5: 105,083,730 D330G probably benign Het
Gin1 T C 1: 97,792,539 S509P possibly damaging Het
Gm15922 A T 7: 3,736,504 L455Q probably damaging Het
Gm17067 A C 7: 42,708,482 S199A probably benign Het
Grk4 A T 5: 34,674,537 K50M probably damaging Het
Inpp4b A G 8: 81,902,852 H272R probably benign Het
Ipo7 T A 7: 110,027,129 L48Q probably damaging Het
Kbtbd2 A G 6: 56,779,206 I515T probably damaging Het
Kcnu1 T A 8: 25,861,180 S190R possibly damaging Het
Kpnb1 T C 11: 97,173,270 N336S probably benign Het
Lbr G T 1: 181,832,155 D158E probably benign Het
Nectin3 T A 16: 46,411,109 T21S probably benign Het
Numb C A 12: 83,797,262 R383L probably damaging Het
Olfr1370 A T 13: 21,072,583 N239K probably damaging Het
Olfr461 G T 6: 40,544,713 Q89K possibly damaging Het
Park2 T C 17: 12,004,052 F363S probably damaging Het
Pcdhb11 A T 18: 37,422,159 I181F probably benign Het
Pcgf2 T A 11: 97,692,409 probably null Het
Pdzd8 T C 19: 59,300,983 T662A probably benign Het
Pex13 A C 11: 23,655,690 V180G probably benign Het
Pkp4 T A 2: 59,214,747 V22D probably benign Het
Ppp1r32 T C 19: 10,479,481 N167D probably damaging Het
Prpf4b A C 13: 34,901,433 D954A probably damaging Het
Rfx8 T C 1: 39,680,965 I317V probably benign Het
Rnaseh2b T C 14: 62,361,419 S198P probably damaging Het
Rock1 A T 18: 10,116,778 C453S possibly damaging Het
Scarf1 G T 11: 75,515,669 G260W probably damaging Het
Scyl1 T C 19: 5,760,571 E538G probably damaging Het
Sec14l5 A T 16: 5,172,995 I267F probably damaging Het
Senp6 T A 9: 80,113,806 V256D probably benign Het
Sf3b4 G A 3: 96,176,728 probably benign Het
Ssh1 T C 5: 113,961,347 probably null Het
Tas2r143 A C 6: 42,400,835 M200L probably benign Het
Tbc1d22a C T 15: 86,214,629 P19S probably damaging Het
Tmc5 T A 7: 118,633,966 M1K probably null Het
Tnc T C 4: 64,000,733 Y1151C probably damaging Het
Tshz3 A G 7: 36,769,441 E285G probably damaging Het
Txndc11 C T 16: 11,084,792 V664M probably damaging Het
Ube2g1 A T 11: 72,663,082 N20Y probably damaging Het
Ufl1 T A 4: 25,265,476 I369L probably benign Het
Vwf A T 6: 125,683,526 T2666S probably benign Het
Yif1a A G 19: 5,092,341 M259V probably benign Het
Zbtb46 T C 2: 181,391,455 D471G probably damaging Het
Other mutations in Mphosph10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mphosph10 APN 7 64389755 missense probably benign 0.00
IGL02113:Mphosph10 APN 7 64376807 unclassified probably benign
IGL02615:Mphosph10 APN 7 64381045 splice site probably benign
R0280:Mphosph10 UTSW 7 64376703 missense possibly damaging 0.92
R0372:Mphosph10 UTSW 7 64388855 unclassified probably benign
R0503:Mphosph10 UTSW 7 64389893 missense probably benign
R0548:Mphosph10 UTSW 7 64378800 missense probably benign 0.45
R1158:Mphosph10 UTSW 7 64388859 unclassified probably benign
R1271:Mphosph10 UTSW 7 64390084 splice site probably null
R1447:Mphosph10 UTSW 7 64380950 missense probably damaging 1.00
R1501:Mphosph10 UTSW 7 64389504 missense probably damaging 1.00
R1815:Mphosph10 UTSW 7 64392170 missense probably benign 0.05
R1900:Mphosph10 UTSW 7 64381028 missense possibly damaging 0.61
R1997:Mphosph10 UTSW 7 64387447 critical splice donor site probably null
R2058:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2059:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2292:Mphosph10 UTSW 7 64385771 missense probably damaging 1.00
R4658:Mphosph10 UTSW 7 64388974 splice site probably null
R4817:Mphosph10 UTSW 7 64392221 unclassified probably benign
R4968:Mphosph10 UTSW 7 64382908 missense probably damaging 1.00
R5121:Mphosph10 UTSW 7 64389596 missense probably damaging 1.00
R5187:Mphosph10 UTSW 7 64385820 missense possibly damaging 0.49
R5304:Mphosph10 UTSW 7 64388984 missense probably damaging 1.00
R5469:Mphosph10 UTSW 7 64389445 critical splice donor site probably null
R6179:Mphosph10 UTSW 7 64378781 missense possibly damaging 0.66
R6632:Mphosph10 UTSW 7 64385819 missense probably damaging 1.00
R6996:Mphosph10 UTSW 7 64388921 missense probably benign 0.07
R8531:Mphosph10 UTSW 7 64384328 missense possibly damaging 0.66
R8844:Mphosph10 UTSW 7 64377339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGTCAGATTTCCTGGAGC -3'
(R):5'- CCAATAGAATTCAGAATGGACTAGC -3'

Sequencing Primer
(F):5'- CAGATTTCCTGGAGCTTTTGGC -3'
(R):5'- TCAGAATGGACTAGCATCAAACTTC -3'
Posted On2018-04-27