Mutagenetix > Incidental Mutations

Incidental Mutation 'R6522:Dip2c'

521408

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.448) question?

Stock #

R6522 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 9575228 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552] [ENSMUST00000174552]

Predicted Effect

probably null
Transcript: ENSMUST00000166299

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166299

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169960

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000174552

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000174552

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Meta Mutation Damage Score

0.9477

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	A	10: 10,377,892	E1209*	probably null	Het
Adgrg5	G	T	8: 94,942,068	R503L	probably benign	Het
Anks1b	C	T	10: 90,897,327		probably benign	Het
Anxa5	A	T	3: 36,465,302	F13I	probably damaging	Het
Bicd1	A	G	6: 149,484,005	I79V	probably benign	Het
Bnip1	A	G	17: 26,789,745	D107G	probably damaging	Het
Ccdc42	A	G	11: 68,588,220	E78G	probably damaging	Het
Ccnk	A	G	12: 108,187,187	D69G	probably damaging	Het
Clec2i	G	T	6: 128,893,729	V77F	probably damaging	Het
Clec4g	A	C	8: 3,718,803	V62G	probably benign	Het
Col4a4	G	A	1: 82,487,583	A957V	unknown	Het
Csnk1d	A	G	11: 120,971,623	F277L	probably damaging	Het
Dpf2	T	A	19: 5,905,532	K108*	probably null	Het
Dync1h1	G	A	12: 110,616,737	D423N	probably damaging	Het
Fbxl13	T	C	5: 21,561,556		probably null	Homo
Flad1	T	C	3: 89,403,183	R488G	probably damaging	Het
Galnt6	A	C	15: 100,693,355	*623E	probably null	Het
Gtf2e1	T	C	16: 37,511,454	T420A	possibly damaging	Het
Hspg2	T	C	4: 137,555,275	V3442A	probably damaging	Het
Itpr1	A	G	6: 108,388,276	D55G	probably damaging	Het
Kdm2a	C	A	19: 4,324,826	R759L	possibly damaging	Het
Kif19a	A	G	11: 114,785,779	E478G	probably damaging	Het
Lamb3	G	A	1: 193,335,453	V881I	probably benign	Het
Map3k6	T	C	4: 133,250,024	L894P	possibly damaging	Het
Mast4	A	G	13: 102,761,293		probably null	Het
Mst1r	G	A	9: 107,913,239	V684M	probably benign	Het
Naa15	T	C	3: 51,471,514	S727P	probably damaging	Het
Nap1l1	T	C	10: 111,494,223	L330S	probably damaging	Het
Nav2	A	G	7: 49,597,533	T2205A	probably damaging	Het
Ncf2	T	C	1: 152,827,463		probably null	Het
Olfr1199	T	C	2: 88,756,108	D189G	probably damaging	Het
Olfr503	G	A	7: 108,544,995	V155I	probably benign	Het
Olfr622	T	C	7: 103,639,297	Y281C	probably damaging	Het
Opa1	T	A	16: 29,625,514	N839K	probably benign	Het
Pcdha7	T	C	18: 36,973,942	Y7H	possibly damaging	Het
Pcdhb15	T	C	18: 37,474,261	V182A	probably benign	Het
Phf10	A	T	17: 14,956,007	I128N	probably damaging	Het
Plce1	T	A	19: 38,748,521		probably null	Het
Plxnb2	T	C	15: 89,164,426	N626S	probably benign	Het
Prh1	G	A	6: 132,572,033	G168R	unknown	Het
Prss51	A	G	14: 64,097,406	T137A	possibly damaging	Het
Ptprcap	C	T	19: 4,156,184	R89C	possibly damaging	Het
Scfd1	A	G	12: 51,431,541	K512R	probably benign	Het
Serpina1b	A	C	12: 103,735,037		probably null	Het
Setbp1	T	C	18: 78,857,390	T1021A	probably damaging	Het
Slco1b2	G	A	6: 141,655,419		probably null	Het
Snrnp200	C	T	2: 127,221,827	T642I	probably benign	Het
Tenm4	A	C	7: 96,843,044	I1063L	possibly damaging	Het
Tfb2m	G	A	1: 179,546,046	A29V	probably benign	Het
Tfeb	T	C	17: 47,789,702	V140A	probably damaging	Het
Tmem104	A	T	11: 115,243,753	I372F	probably damaging	Het
Tmem132d	G	T	5: 127,783,768	H1096Q	probably benign	Het
Trim12c	A	T	7: 104,348,324	N8K	probably benign	Het
Tti2	A	G	8: 31,153,603	I249V	probably null	Het
Vps8	T	A	16: 21,442,379	L90I	probably damaging	Het
Vwf	A	T	6: 125,662,963		probably null	Het
Wdfy4	A	G	14: 33,146,944	S376P	probably damaging	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTGGCTTACATGTGTCC -3'
(R):5'- ACAGGTTGACATCTCTCTGATCTC -3'

Sequencing Primer
(F):5'- ACATGTGTCCCCTGCATCGG -3'
(R):5'- TCTGTGTGCTACAAGTGCCCAG -3'

Posted On

2018-06-06