Mutagenetix > Incidental Mutations

Incidental Mutation 'R6563:L3mbtl3'

522553

Institutional Source

Beutler Lab

Gene Symbol

L3mbtl3

Ensembl Gene

ENSMUSG00000039089

Gene Name

L3MBTL3 histone methyl-lysine binding protein

Synonyms

MBT-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6563 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26274468-26375971 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 26302863 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]

Predicted Effect

probably null
Transcript: ENSMUST00000040219

SMART Domains

Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000105519

SMART Domains

Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089

Domain	Start	End	E-Value	Type
low complexity region	129	141	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
MBT	207	307	3.75e-48	SMART
MBT	315	414	3.67e-42	SMART
MBT	423	518	7.5e-48	SMART
low complexity region	579	590	N/A	INTRINSIC
low complexity region	637	745	N/A	INTRINSIC
SAM	783	850	2.49e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000174766

SMART Domains

Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218585

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218665

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410131K14Rik	T	C	5: 118,258,982	V92A	possibly damaging	Het
Arhgap11a	A	T	2: 113,833,902	C679S	probably benign	Het
Atg4d	C	T	9: 21,268,460	L235F	possibly damaging	Het
Cyp2d22	A	T	15: 82,371,912	W174R	probably damaging	Het
Cyp4a14	T	A	4: 115,492,086	H259L	probably benign	Het
Dennd3	A	T	15: 73,544,380	H493L	probably damaging	Het
Diexf	C	A	1: 193,118,390	R374L	probably damaging	Het
Dnm1	T	A	2: 32,312,726	D759V	probably damaging	Het
Dvl1	T	A	4: 155,856,253	N443K	probably damaging	Het
Dync2h1	A	G	9: 7,120,819	V2156A	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ermp1	T	C	19: 29,623,778	D523G	probably damaging	Het
Fam83c	A	G	2: 155,830,952	V295A	probably damaging	Het
Gphn	T	C	12: 78,680,396		probably null	Het
Irs1	T	A	1: 82,288,407	N696I	probably damaging	Het
Kmt5c	A	G	7: 4,742,629	Y96C	probably damaging	Het
Krt77	G	T	15: 101,862,923	T315N	probably damaging	Het
Lama3	A	T	18: 12,537,766	Y2409F	probably damaging	Het
Lrrc9	A	G	12: 72,486,395		probably null	Het
Ltbp4	A	T	7: 27,309,063	N1273K	probably damaging	Het
Mfsd13b	G	A	7: 120,995,467	A321T	probably damaging	Het
Mvb12b	A	T	2: 33,825,116	H167Q	probably benign	Het
Myo1g	T	A	11: 6,517,146	N230Y	possibly damaging	Het
Olfr57	A	T	10: 79,035,217	R140S	possibly damaging	Het
Prkar2b	G	T	12: 31,993,786		probably null	Het
Pwwp2a	G	T	11: 43,705,765	A586S	possibly damaging	Het
Ryr1	A	G	7: 29,095,492	V1150A	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,943		probably null	Het
Slk	T	C	19: 47,636,469		probably null	Het
Snx3	A	G	10: 42,526,036	E82G	possibly damaging	Het
Srcin1	A	T	11: 97,534,774	Y486N	possibly damaging	Het
Tecpr2	A	G	12: 110,929,087	E336G	probably benign	Het
Terf2ip	G	T	8: 112,018,202	V384F	probably damaging	Het
Tnn	T	A	1: 160,088,398	S1250C	probably damaging	Het
Tspoap1	A	G	11: 87,777,159	E1263G	possibly damaging	Het
Tubgcp5	A	G	7: 55,825,661	R932G	possibly damaging	Het
Vmn1r175	A	G	7: 23,808,605	I199T	possibly damaging	Het
Vmn1r225	C	T	17: 20,502,501	A68V	probably benign	Het
Vmn2r24	A	T	6: 123,804,178	N448Y	possibly damaging	Het

Other mutations in L3mbtl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:L3mbtl3	APN	10	26313846	critical splice donor site	probably null
IGL01357:L3mbtl3	APN	10	26330185	missense	unknown
IGL01712:L3mbtl3	APN	10	26276235	missense	probably damaging	0.96
IGL01759:L3mbtl3	APN	10	26331900	missense	unknown
IGL01928:L3mbtl3	APN	10	26330245	missense	unknown
IGL01955:L3mbtl3	APN	10	26318438	missense	unknown
IGL02674:L3mbtl3	APN	10	26282813	missense	unknown
IGL02731:L3mbtl3	APN	10	26344176	critical splice donor site	probably null
IGL03188:L3mbtl3	APN	10	26342617	missense	unknown
IGL03252:L3mbtl3	APN	10	26331812	splice site	probably benign
IGL03298:L3mbtl3	APN	10	26282798	missense	unknown
IGL03400:L3mbtl3	APN	10	26315526	missense	unknown
R0121:L3mbtl3	UTSW	10	26313870	missense	unknown
R0468:L3mbtl3	UTSW	10	26327732	missense	unknown
R0497:L3mbtl3	UTSW	10	26282874	splice site	probably benign
R0586:L3mbtl3	UTSW	10	26327834	missense	unknown
R0633:L3mbtl3	UTSW	10	26302685	missense	unknown
R0679:L3mbtl3	UTSW	10	26313933	nonsense	probably null
R1302:L3mbtl3	UTSW	10	26327769	missense	unknown
R2128:L3mbtl3	UTSW	10	26313868	missense	unknown
R2267:L3mbtl3	UTSW	10	26331857	nonsense	probably null
R3121:L3mbtl3	UTSW	10	26344221	intron	probably benign
R3410:L3mbtl3	UTSW	10	26339299	missense	unknown
R4237:L3mbtl3	UTSW	10	26340948	missense	unknown
R4257:L3mbtl3	UTSW	10	26280122	missense	unknown
R4308:L3mbtl3	UTSW	10	26282792	missense	unknown
R4359:L3mbtl3	UTSW	10	26327741	missense	unknown
R4407:L3mbtl3	UTSW	10	26313884	missense	unknown
R4613:L3mbtl3	UTSW	10	26282795	missense	unknown
R4663:L3mbtl3	UTSW	10	26337817	missense	unknown
R4843:L3mbtl3	UTSW	10	26331879	missense	unknown
R4886:L3mbtl3	UTSW	10	26292770	missense	unknown
R5158:L3mbtl3	UTSW	10	26303688	missense	unknown
R5247:L3mbtl3	UTSW	10	26327808	missense	unknown
R5580:L3mbtl3	UTSW	10	26303706	missense	unknown
R5966:L3mbtl3	UTSW	10	26331864	missense	unknown
R6218:L3mbtl3	UTSW	10	26292747	missense	unknown
R6508:L3mbtl3	UTSW	10	26318427	missense	unknown
R6709:L3mbtl3	UTSW	10	26282797	missense	unknown
R6927:L3mbtl3	UTSW	10	26292669	nonsense	probably null
R6984:L3mbtl3	UTSW	10	26282855	missense	unknown
R7010:L3mbtl3	UTSW	10	26282861	critical splice acceptor site	probably null
R7229:L3mbtl3	UTSW	10	26292662	missense	unknown
R7231:L3mbtl3	UTSW	10	26339282	missense	unknown
R7296:L3mbtl3	UTSW	10	26282830	missense	unknown
R7363:L3mbtl3	UTSW	10	26340952	missense	unknown
R7490:L3mbtl3	UTSW	10	26339231	missense	unknown
R7775:L3mbtl3	UTSW	10	26352317	missense	unknown
R7815:L3mbtl3	UTSW	10	26280378	missense	unknown
R8272:L3mbtl3	UTSW	10	26303668	missense	unknown
Z1177:L3mbtl3	UTSW	10	26280402	nonsense	probably null
Z1177:L3mbtl3	UTSW	10	26302663	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTGAGTGCCCAGGTATCTC -3'
(R):5'- ACCTCTGTAGTCTGACACCTTAAAAG -3'

Sequencing Primer
(F):5'- TTTTTAAAATGACCAACACCCCTG -3'
(R):5'- GAACCATGGGGAAACCTTA -3'

Posted On

2018-06-06