Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Sorbs1'

617988

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.760) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40294753-40513779 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 40326489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 626 (M626I)

Ref Sequence

ENSEMBL: ENSMUSP00000153009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099466

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099467

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165212

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165469

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224247

Predicted Effect

probably benign
Transcript: ENSMUST00000224667
AA Change: M626I

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000225148

Predicted Effect

probably benign
Transcript: ENSMUST00000225153

Predicted Effect

probably benign
Transcript: ENSMUST00000225786

Predicted Effect

probably benign
Transcript: ENSMUST00000226047

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Spink5	T	A	18: 44,010,236	D753E	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40318029	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40344351	splice site	probably null
IGL00788:Sorbs1	APN	19	40337043	splice site	probably benign
IGL00943:Sorbs1	APN	19	40295040	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40349978	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40376647	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40318016	splice site	probably benign
IGL02159:Sorbs1	APN	19	40327596	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40314397	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40327547	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40365133	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40314681	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40376904	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40376743	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40314376	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40363262	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40344414	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40373565	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0306:Sorbs1	UTSW	19	40344411	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40349948	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40311816	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40363262	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40393460	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40365028	splice site	probably null
R2148:Sorbs1	UTSW	19	40376824	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40296631	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40373515	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40373571	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40314443	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40395745	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40311850	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40373518	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40340047	nonsense	probably null
R4912:Sorbs1	UTSW	19	40311727	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40340707	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40321890	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40376989	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40376881	missense	probably benign
R5871:Sorbs1	UTSW	19	40398583	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40324772	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40314657	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40321819	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40376982	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40326052	missense	probably benign
R6646:Sorbs1	UTSW	19	40325549	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40327547	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40376800	missense	probably benign
R6850:Sorbs1	UTSW	19	40376800	missense	probably benign
R6878:Sorbs1	UTSW	19	40376800	missense	probably benign
R6879:Sorbs1	UTSW	19	40376800	missense	probably benign
R6880:Sorbs1	UTSW	19	40376800	missense	probably benign
R6908:Sorbs1	UTSW	19	40352332	missense	probably damaging	1.00
R6980:Sorbs1	UTSW	19	40327616	nonsense	probably null
R7040:Sorbs1	UTSW	19	40376800	missense	probably benign
R7041:Sorbs1	UTSW	19	40376800	missense	probably benign
R7110:Sorbs1	UTSW	19	40376800	missense	probably benign
R7122:Sorbs1	UTSW	19	40376800	missense	probably benign
R7170:Sorbs1	UTSW	19	40326129	nonsense	probably null
R7180:Sorbs1	UTSW	19	40376800	missense	probably benign
R7185:Sorbs1	UTSW	19	40376800	missense	probably benign
R7187:Sorbs1	UTSW	19	40376800	missense	probably benign
R7254:Sorbs1	UTSW	19	40376800	missense	probably benign
R7255:Sorbs1	UTSW	19	40376800	missense	probably benign
R7401:Sorbs1	UTSW	19	40376800	missense	probably benign
R7595:Sorbs1	UTSW	19	40314653	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40376800	missense	probably benign
R7876:Sorbs1	UTSW	19	40296588	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40327576	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40365005	missense	probably damaging	0.99
R8082:Sorbs1	UTSW	19	40365083	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40376800	missense	probably benign
R8283:Sorbs1	UTSW	19	40376800	missense	probably benign
R8446:Sorbs1	UTSW	19	40326158	missense	probably benign
R8526:Sorbs1	UTSW	19	40376800	missense	probably benign
R8527:Sorbs1	UTSW	19	40376800	missense	probably benign
R8528:Sorbs1	UTSW	19	40376800	missense	probably benign
R8539:Sorbs1	UTSW	19	40376800	missense	probably benign
R8540:Sorbs1	UTSW	19	40376800	missense	probably benign
R8542:Sorbs1	UTSW	19	40376800	missense	probably benign
R8543:Sorbs1	UTSW	19	40376800	missense	probably benign
R8544:Sorbs1	UTSW	19	40376800	missense	probably benign
R8545:Sorbs1	UTSW	19	40376800	missense	probably benign
R8684:Sorbs1	UTSW	19	40376800	missense	probably benign
R8699:Sorbs1	UTSW	19	40376800	missense	probably benign
R8702:Sorbs1	UTSW	19	40376800	missense	probably benign
R8752:Sorbs1	UTSW	19	40361428	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40373562	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40363216	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40326574	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40365018	start gained	probably benign
R9211:Sorbs1	UTSW	19	40344354	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40326880	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9377:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
Z1177:Sorbs1	UTSW	19	40326895	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AATGAGCTGCTCAAAGGCCG -3'
(R):5'- TGTGAGAACCTCTGTGTGTC -3'

Sequencing Primer
(F):5'- TGCTCAAAGGCCGTGATG -3'
(R):5'- TTGAATGATTCCAAAAGAGGCCTCC -3'

Posted On

2020-01-23