Incidental Mutation 'R7254:Arid3b'
ID 564141
Institutional Source Beutler Lab
Gene Symbol Arid3b
Ensembl Gene ENSMUSG00000004661
Gene Name AT rich interactive domain 3B (BRIGHT-like)
Synonyms Bdp, Dri2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57790353-57836793 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57796754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 304 (K304E)
Ref Sequence ENSEMBL: ENSMUSP00000004780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004780] [ENSMUST00000098686] [ENSMUST00000114165] [ENSMUST00000164010] [ENSMUST00000164035] [ENSMUST00000170477] [ENSMUST00000171444] [ENSMUST00000171949]
AlphaFold Q9Z1N7
Predicted Effect probably damaging
Transcript: ENSMUST00000004780
AA Change: K304E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004780
Gene: ENSMUSG00000004661
AA Change: K304E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098686
AA Change: K304E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096283
Gene: ENSMUSG00000004661
AA Change: K304E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114165
SMART Domains Protein: ENSMUSP00000109802
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164010
SMART Domains Protein: ENSMUSP00000126889
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 240 6e-9 SMART
PDB:4LJX|B 204 238 4e-9 PDB
Blast:ARID 210 231 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164035
SMART Domains Protein: ENSMUSP00000131677
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 233 2e-8 SMART
PDB:4LJX|B 204 268 1e-10 PDB
Blast:ARID 210 267 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170477
Predicted Effect probably damaging
Transcript: ENSMUST00000171444
AA Change: K304E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130173
Gene: ENSMUSG00000004661
AA Change: K304E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171949
SMART Domains Protein: ENSMUSP00000127525
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 54 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA-binding proteins. The encoded protein is homologous with two proteins that bind to the retinoblastoma gene product, and also with the mouse Bright and Drosophila dead ringer proteins. A pseudogene on chromosome 1p31 exists for this gene. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E11.5 displaying variable phenotypes associated with impaired generation of cranial-mesenchymal cells in the first and second branchial arches. Common defects include a wavy neural tube, small branchial arches, and a defective cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Adnp A G 2: 168,183,998 V459A probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Arid3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Arid3b APN 9 57833924 missense possibly damaging 0.92
IGL01394:Arid3b APN 9 57795034 missense probably damaging 1.00
IGL01950:Arid3b APN 9 57794974 missense probably damaging 1.00
R0970:Arid3b UTSW 9 57833551 intron probably benign
R1848:Arid3b UTSW 9 57796677 nonsense probably null
R1940:Arid3b UTSW 9 57796148 missense possibly damaging 0.86
R4290:Arid3b UTSW 9 57790430 unclassified probably benign
R4293:Arid3b UTSW 9 57790430 unclassified probably benign
R4424:Arid3b UTSW 9 57833868 missense probably benign 0.22
R4449:Arid3b UTSW 9 57798121 nonsense probably null
R5353:Arid3b UTSW 9 57795037 splice site probably null
R5544:Arid3b UTSW 9 57798097 nonsense probably null
R6828:Arid3b UTSW 9 57810163 critical splice donor site probably null
R7168:Arid3b UTSW 9 57805535 missense probably benign 0.00
R7398:Arid3b UTSW 9 57796212 missense probably benign 0.01
R7882:Arid3b UTSW 9 57796497 missense possibly damaging 0.85
R7891:Arid3b UTSW 9 57810159 missense probably benign 0.00
R8877:Arid3b UTSW 9 57833621 missense probably damaging 0.99
R9043:Arid3b UTSW 9 57792617 missense possibly damaging 0.75
R9094:Arid3b UTSW 9 57834044 missense probably damaging 1.00
R9186:Arid3b UTSW 9 57794934 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGAGAGTAGATGCCGG -3'
(R):5'- GTGTCATGTGAGCTTAGTAGACC -3'

Sequencing Primer
(F):5'- AGTAGATGCCGGGGGTATCC -3'
(R):5'- AGACCCTTCTACTATGTGTACCAC -3'
Posted On 2019-06-26