Incidental Mutation 'R7254:Adnp'
ID 564123
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Name activity-dependent neuroprotective protein
Synonyms mKIAA0784
MMRRC Submission
Accession Numbers

Genbank: NM_009628; MGI: 1338758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7254 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 168180986-168207112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 168183998 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 459 (V459A)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
AlphaFold Q9Z103
Predicted Effect probably damaging
Transcript: ENSMUST00000057793
AA Change: V459A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: V459A

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088001
AA Change: V459A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: V459A

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,741,976 I677V probably benign Het
4931406B18Rik A T 7: 43,498,199 D249E probably damaging Het
Acacb A C 5: 114,209,751 probably null Het
Arid3b T C 9: 57,796,754 K304E probably damaging Het
Ash1l G T 3: 89,070,509 R2713L probably damaging Het
Bmpr1a A C 14: 34,414,763 D490E probably benign Het
Cacna1g A T 11: 94,432,567 C1270* probably null Het
Cep295nl G T 11: 118,333,040 P326Q probably damaging Het
Cfap100 T C 6: 90,406,061 I377V unknown Het
Creb1 C T 1: 64,576,277 Q223* probably null Het
Ctsc G A 7: 88,309,559 G349D probably damaging Het
Ddx41 G A 13: 55,533,956 R311* probably null Het
Dse T A 10: 34,184,148 probably benign Het
Eef2k C T 7: 120,889,265 H458Y probably benign Het
Gipr A T 7: 19,163,613 V90E probably damaging Het
Gm14412 A T 2: 177,317,396 D22E probably damaging Het
Gm17018 A G 19: 45,577,034 Q149R probably benign Het
Gm21886 A T 18: 80,089,735 C69* probably null Het
Gm5114 G A 7: 39,408,966 L410F probably benign Het
Gmip T A 8: 69,816,468 probably null Het
Gtf2f1 T C 17: 57,007,101 T128A possibly damaging Het
Hnrnpr A G 4: 136,332,575 E330G possibly damaging Het
Hoxd9 T A 2: 74,698,374 W107R probably damaging Het
Iars T C 13: 49,723,078 probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ifi213 G T 1: 173,593,963 P120Q probably damaging Het
Il6 A T 5: 30,014,908 Q94L probably benign Het
Kcnab1 A G 3: 65,319,487 S196G probably benign Het
Kcnv1 C T 15: 45,113,208 V228I probably benign Het
Lars2 A G 9: 123,454,963 T739A possibly damaging Het
Med13 T C 11: 86,319,835 S494G probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh9 T G 15: 77,765,824 Q1646P probably damaging Het
Nif3l1 T A 1: 58,450,466 S171R probably benign Het
Olfr143 T C 9: 38,253,423 M2T probably benign Het
Olfr1467 A T 19: 13,365,111 D161V probably benign Het
Olfr376 A G 11: 73,375,375 I212V probably benign Het
Olfr398 A G 11: 73,983,777 V277A probably benign Het
Olfr564 A G 7: 102,803,558 T27A probably benign Het
Olfr702 A G 7: 106,823,570 *319Q probably null Het
Olfr785 T C 10: 129,409,780 V138A probably benign Het
Pak7 A T 2: 136,116,764 S135T possibly damaging Het
Prr29 A T 11: 106,374,858 M1L probably damaging Het
Ptpn13 T A 5: 103,594,636 V2407E probably damaging Het
Ralgapa1 T A 12: 55,695,193 H1310L probably damaging Het
Raph1 T C 1: 60,499,608 S393G unknown Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Ror2 A G 13: 53,118,720 I303T possibly damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn10a C T 9: 119,618,855 D1378N probably damaging Het
Serpinc1 T A 1: 160,993,618 C91S probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tada1 T A 1: 166,388,648 C139* probably null Het
Tbr1 T A 2: 61,806,042 V254E probably damaging Het
Timd4 A T 11: 46,843,189 I340F probably benign Het
Tubb2a T C 13: 34,074,532 Y425C probably damaging Het
Wdr60 A G 12: 116,262,585 probably benign Het
Zfp292 A T 4: 34,819,476 M287K probably damaging Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168182562 missense probably benign
IGL00500:Adnp APN 2 168183323 missense possibly damaging 0.85
IGL01604:Adnp APN 2 168184338 missense probably damaging 0.99
IGL01967:Adnp APN 2 168183419 missense possibly damaging 0.85
IGL02470:Adnp APN 2 168183194 missense probably damaging 0.99
C9142:Adnp UTSW 2 168184407 missense probably damaging 0.99
R0893:Adnp UTSW 2 168183727 missense possibly damaging 0.85
R1167:Adnp UTSW 2 168184500 missense probably benign 0.11
R1182:Adnp UTSW 2 168184796 missense possibly damaging 0.77
R1480:Adnp UTSW 2 168183534 missense probably damaging 0.99
R1505:Adnp UTSW 2 168183741 missense possibly damaging 0.93
R1906:Adnp UTSW 2 168182367 missense probably benign
R3711:Adnp UTSW 2 168184823 missense probably damaging 0.98
R3943:Adnp UTSW 2 168185060 missense possibly damaging 0.92
R4440:Adnp UTSW 2 168184801 missense possibly damaging 0.92
R4686:Adnp UTSW 2 168182389 missense possibly damaging 0.78
R4916:Adnp UTSW 2 168187617 missense possibly damaging 0.91
R5072:Adnp UTSW 2 168183001 missense probably damaging 0.96
R5312:Adnp UTSW 2 168184188 missense probably benign
R5393:Adnp UTSW 2 168182949 missense possibly damaging 0.95
R5598:Adnp UTSW 2 168183725 missense probably damaging 0.99
R6230:Adnp UTSW 2 168182532 missense probably benign
R7165:Adnp UTSW 2 168182367 missense probably benign 0.07
R7176:Adnp UTSW 2 168182658 missense probably benign
R7238:Adnp UTSW 2 168183967 missense probably damaging 1.00
R7581:Adnp UTSW 2 168183466 missense probably damaging 0.96
R7676:Adnp UTSW 2 168183447 nonsense probably null
R7863:Adnp UTSW 2 168189350 missense possibly damaging 0.91
R8098:Adnp UTSW 2 168182532 missense probably benign
R8196:Adnp UTSW 2 168183172 missense probably benign
R8970:Adnp UTSW 2 168189370 missense possibly damaging 0.91
R9153:Adnp UTSW 2 168184660 missense possibly damaging 0.96
R9154:Adnp UTSW 2 168184660 missense possibly damaging 0.96
R9228:Adnp UTSW 2 168184878 missense probably damaging 0.98
R9256:Adnp UTSW 2 168184025 missense probably damaging 1.00
R9268:Adnp UTSW 2 168189313 missense possibly damaging 0.86
R9434:Adnp UTSW 2 168184457 missense probably damaging 0.99
R9517:Adnp UTSW 2 168182946 missense possibly damaging 0.93
R9621:Adnp UTSW 2 168182743 missense probably benign 0.22
R9669:Adnp UTSW 2 168184998 missense possibly damaging 0.91
R9737:Adnp UTSW 2 168184998 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCATTGAAGGTGGAACGGC -3'
(R):5'- GGTGGCAATGCTCCAGTTTC -3'

Sequencing Primer
(F):5'- TCATTGAAGGTGGAACGGCAATAC -3'
(R):5'- CCGTGAAACAGTTACTTCCAAGTGG -3'
Posted On 2019-06-26