Incidental Mutation 'R7640:Zfp423'
ID 590190
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Name zinc finger protein 423
Synonyms Roaz, Zfp104, Ebfaz, ataxia1
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.832) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 88388438-88686223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88507905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 813 (K813R)
Ref Sequence ENSEMBL: ENSMUSP00000105282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000165770] [ENSMUST00000174249] [ENSMUST00000174764]
AlphaFold Q80TS5
Predicted Effect probably damaging
Transcript: ENSMUST00000052250
AA Change: K792R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: K792R

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
ZnF_C2H2 54 75 5.07e0 SMART
low complexity region 107 123 N/A INTRINSIC
ZnF_C2H2 125 147 1.28e-3 SMART
ZnF_C2H2 153 175 1.64e-1 SMART
ZnF_C2H2 181 203 2.05e-2 SMART
ZnF_C2H2 209 231 3.21e-4 SMART
ZnF_C2H2 250 273 5.42e-2 SMART
ZnF_C2H2 282 305 1.76e-1 SMART
ZnF_C2H2 310 332 8.67e-1 SMART
low complexity region 350 364 N/A INTRINSIC
ZnF_C2H2 396 420 1.16e-1 SMART
ZnF_C2H2 428 451 3.52e-1 SMART
ZnF_C2H2 467 490 7.9e-4 SMART
low complexity region 492 503 N/A INTRINSIC
ZnF_C2H2 504 527 2.53e-2 SMART
ZnF_C2H2 550 575 3.99e0 SMART
low complexity region 591 602 N/A INTRINSIC
ZnF_C2H2 619 641 3.16e-3 SMART
ZnF_C2H2 649 671 5.81e-2 SMART
ZnF_C2H2 679 702 4.87e-4 SMART
ZnF_C2H2 707 730 7.26e-3 SMART
ZnF_C2H2 737 760 4.79e-3 SMART
ZnF_C2H2 768 790 1.36e-2 SMART
ZnF_C2H2 794 817 4.72e-2 SMART
ZnF_C2H2 873 896 4.12e0 SMART
ZnF_C2H2 917 939 5.59e-4 SMART
ZnF_C2H2 946 968 6.42e-4 SMART
ZnF_C2H2 975 997 4.94e0 SMART
ZnF_C2H2 1007 1029 4.99e1 SMART
Pfam:zf-C2H2_6 1050 1068 1.6e-1 PFAM
ZnF_C2H2 1107 1130 1.12e-3 SMART
ZnF_C2H2 1155 1177 1.45e-2 SMART
ZnF_C2H2 1185 1207 5.72e-1 SMART
ZnF_C2H2 1216 1239 1.18e-2 SMART
ZnF_C2H2 1246 1269 4.05e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109655
AA Change: K813R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: K813R

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165770
AA Change: K688R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129724
Gene: ENSMUSG00000045333
AA Change: K688R

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
ZnF_C2H2 21 43 1.28e-3 SMART
ZnF_C2H2 49 71 1.64e-1 SMART
ZnF_C2H2 77 99 2.05e-2 SMART
ZnF_C2H2 105 127 3.21e-4 SMART
ZnF_C2H2 146 169 5.42e-2 SMART
ZnF_C2H2 178 201 1.76e-1 SMART
ZnF_C2H2 206 228 8.67e-1 SMART
low complexity region 246 260 N/A INTRINSIC
ZnF_C2H2 292 316 1.16e-1 SMART
ZnF_C2H2 324 347 3.52e-1 SMART
ZnF_C2H2 363 386 7.9e-4 SMART
low complexity region 388 399 N/A INTRINSIC
ZnF_C2H2 400 423 2.53e-2 SMART
ZnF_C2H2 446 471 3.99e0 SMART
low complexity region 487 498 N/A INTRINSIC
ZnF_C2H2 515 537 3.16e-3 SMART
ZnF_C2H2 545 567 5.81e-2 SMART
ZnF_C2H2 575 598 4.87e-4 SMART
ZnF_C2H2 603 626 7.26e-3 SMART
ZnF_C2H2 633 656 4.79e-3 SMART
ZnF_C2H2 664 686 1.36e-2 SMART
ZnF_C2H2 690 713 4.72e-2 SMART
ZnF_C2H2 769 792 4.12e0 SMART
ZnF_C2H2 813 835 5.59e-4 SMART
ZnF_C2H2 842 864 6.42e-4 SMART
ZnF_C2H2 871 893 4.94e0 SMART
ZnF_C2H2 903 925 4.99e1 SMART
Pfam:zf-C2H2_6 946 964 2.5e-1 PFAM
ZnF_C2H2 1003 1026 1.12e-3 SMART
ZnF_C2H2 1051 1073 1.45e-2 SMART
ZnF_C2H2 1081 1103 5.72e-1 SMART
ZnF_C2H2 1112 1135 1.18e-2 SMART
ZnF_C2H2 1142 1165 4.05e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174249
SMART Domains Protein: ENSMUSP00000134103
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
ZnF_C2H2 78 100 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174764
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 88,508,239 (GRCm39) splice site probably null
IGL01359:Zfp423 APN 8 88,507,290 (GRCm39) missense probably damaging 1.00
IGL01780:Zfp423 APN 8 88,508,136 (GRCm39) missense probably damaging 1.00
IGL02250:Zfp423 APN 8 88,509,883 (GRCm39) missense probably damaging 1.00
IGL02301:Zfp423 APN 8 88,508,202 (GRCm39) missense probably damaging 1.00
IGL02320:Zfp423 APN 8 88,508,230 (GRCm39) missense probably damaging 1.00
IGL02804:Zfp423 APN 8 88,509,285 (GRCm39) missense probably benign 0.02
IGL03090:Zfp423 APN 8 88,508,071 (GRCm39) missense probably damaging 1.00
IGL03198:Zfp423 APN 8 88,508,304 (GRCm39) missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 88,586,080 (GRCm39) nonsense probably null
swell UTSW 8 88,413,187 (GRCm39) splice site probably null
Temptation UTSW 8 88,508,381 (GRCm39) missense probably benign 0.25
trials UTSW 8 88,507,341 (GRCm39) missense probably damaging 1.00
R0110:Zfp423 UTSW 8 88,508,887 (GRCm39) missense possibly damaging 0.60
R0142:Zfp423 UTSW 8 88,506,968 (GRCm39) nonsense probably null
R0256:Zfp423 UTSW 8 88,500,262 (GRCm39) nonsense probably null
R0538:Zfp423 UTSW 8 88,508,713 (GRCm39) missense probably damaging 0.99
R0542:Zfp423 UTSW 8 88,507,237 (GRCm39) missense probably damaging 1.00
R0614:Zfp423 UTSW 8 88,508,742 (GRCm39) missense probably damaging 1.00
R1179:Zfp423 UTSW 8 88,414,700 (GRCm39) missense probably damaging 0.97
R1417:Zfp423 UTSW 8 88,500,284 (GRCm39) splice site probably null
R1429:Zfp423 UTSW 8 88,413,070 (GRCm39) missense probably damaging 0.99
R1570:Zfp423 UTSW 8 88,509,186 (GRCm39) missense probably benign 0.37
R2013:Zfp423 UTSW 8 88,509,025 (GRCm39) missense probably benign 0.43
R2043:Zfp423 UTSW 8 88,509,246 (GRCm39) missense probably damaging 1.00
R2064:Zfp423 UTSW 8 88,507,986 (GRCm39) missense probably benign 0.04
R2108:Zfp423 UTSW 8 88,507,806 (GRCm39) missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 88,507,179 (GRCm39) missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 88,508,959 (GRCm39) missense probably damaging 1.00
R3277:Zfp423 UTSW 8 88,508,959 (GRCm39) missense probably damaging 1.00
R3738:Zfp423 UTSW 8 88,507,972 (GRCm39) missense probably damaging 1.00
R3739:Zfp423 UTSW 8 88,507,972 (GRCm39) missense probably damaging 1.00
R3773:Zfp423 UTSW 8 88,507,140 (GRCm39) missense probably benign 0.03
R4034:Zfp423 UTSW 8 88,507,972 (GRCm39) missense probably damaging 1.00
R4425:Zfp423 UTSW 8 88,509,601 (GRCm39) missense probably damaging 1.00
R4611:Zfp423 UTSW 8 88,414,709 (GRCm39) missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 88,508,338 (GRCm39) splice site probably null
R4753:Zfp423 UTSW 8 88,508,074 (GRCm39) missense probably benign 0.00
R4818:Zfp423 UTSW 8 88,631,128 (GRCm39) missense probably benign 0.00
R5026:Zfp423 UTSW 8 88,507,302 (GRCm39) missense probably damaging 1.00
R5190:Zfp423 UTSW 8 88,509,091 (GRCm39) missense probably damaging 1.00
R5243:Zfp423 UTSW 8 88,500,275 (GRCm39) missense probably benign 0.03
R5284:Zfp423 UTSW 8 88,508,305 (GRCm39) missense possibly damaging 0.73
R5586:Zfp423 UTSW 8 88,585,968 (GRCm39) missense possibly damaging 0.93
R5601:Zfp423 UTSW 8 88,508,637 (GRCm39) missense probably damaging 1.00
R5671:Zfp423 UTSW 8 88,508,955 (GRCm39) missense probably damaging 0.99
R5717:Zfp423 UTSW 8 88,413,187 (GRCm39) splice site probably null
R5801:Zfp423 UTSW 8 88,585,990 (GRCm39) missense probably damaging 0.99
R5917:Zfp423 UTSW 8 88,508,860 (GRCm39) nonsense probably null
R5985:Zfp423 UTSW 8 88,508,774 (GRCm39) missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 88,509,315 (GRCm39) missense probably damaging 0.99
R6306:Zfp423 UTSW 8 88,508,662 (GRCm39) missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 88,508,445 (GRCm39) missense probably damaging 0.99
R6970:Zfp423 UTSW 8 88,530,407 (GRCm39) missense probably benign 0.00
R7029:Zfp423 UTSW 8 88,414,694 (GRCm39) missense probably damaging 0.99
R7060:Zfp423 UTSW 8 88,509,507 (GRCm39) missense probably damaging 1.00
R7074:Zfp423 UTSW 8 88,509,060 (GRCm39) missense probably benign 0.00
R7121:Zfp423 UTSW 8 88,507,489 (GRCm39) missense probably damaging 1.00
R7242:Zfp423 UTSW 8 88,631,155 (GRCm39) missense probably benign 0.07
R7359:Zfp423 UTSW 8 88,508,871 (GRCm39) missense possibly damaging 0.52
R7426:Zfp423 UTSW 8 88,507,341 (GRCm39) missense probably damaging 1.00
R7540:Zfp423 UTSW 8 88,414,695 (GRCm39) missense possibly damaging 0.95
R7767:Zfp423 UTSW 8 88,507,512 (GRCm39) missense probably damaging 1.00
R7938:Zfp423 UTSW 8 88,622,304 (GRCm39) missense unknown
R7986:Zfp423 UTSW 8 88,506,978 (GRCm39) missense probably benign 0.04
R8347:Zfp423 UTSW 8 88,509,784 (GRCm39) missense probably damaging 0.99
R8356:Zfp423 UTSW 8 88,509,910 (GRCm39) missense probably damaging 1.00
R8676:Zfp423 UTSW 8 88,509,338 (GRCm39) missense probably benign 0.04
R8710:Zfp423 UTSW 8 88,507,549 (GRCm39) missense possibly damaging 0.74
R8794:Zfp423 UTSW 8 88,507,857 (GRCm39) missense probably damaging 1.00
R8832:Zfp423 UTSW 8 88,507,827 (GRCm39) missense probably damaging 0.98
R9018:Zfp423 UTSW 8 88,508,381 (GRCm39) missense probably benign 0.25
R9182:Zfp423 UTSW 8 88,508,742 (GRCm39) missense probably damaging 0.99
R9309:Zfp423 UTSW 8 88,509,688 (GRCm39) missense probably damaging 0.99
R9312:Zfp423 UTSW 8 88,508,569 (GRCm39) missense probably damaging 1.00
R9453:Zfp423 UTSW 8 88,508,251 (GRCm39) missense probably damaging 1.00
R9469:Zfp423 UTSW 8 88,509,519 (GRCm39) missense probably damaging 0.99
R9480:Zfp423 UTSW 8 88,631,115 (GRCm39) critical splice donor site probably null
R9483:Zfp423 UTSW 8 88,507,725 (GRCm39) missense possibly damaging 0.90
R9510:Zfp423 UTSW 8 88,510,041 (GRCm39) missense possibly damaging 0.94
R9521:Zfp423 UTSW 8 88,509,033 (GRCm39) missense probably damaging 1.00
R9606:Zfp423 UTSW 8 88,414,595 (GRCm39) missense probably damaging 0.99
R9789:Zfp423 UTSW 8 88,506,877 (GRCm39) missense probably benign 0.03
Z1176:Zfp423 UTSW 8 88,586,048 (GRCm39) missense possibly damaging 0.49
Z1177:Zfp423 UTSW 8 88,507,553 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTCTTGAGCAGCATGC -3'
(R):5'- ACTCCAAGGTGTCCATCCAG -3'

Sequencing Primer
(F):5'- CATGCCCTGCAGGTCGG -3'
(R):5'- AAGGTGTCCATCCAGGTGCAC -3'
Posted On 2019-10-24