Incidental Mutation 'R7640:Mknk2'
ID 590198
Institutional Source Beutler Lab
Gene Symbol Mknk2
Ensembl Gene ENSMUSG00000020190
Gene Name MAP kinase-interacting serine/threonine kinase 2
Synonyms Mnk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80665327-80678112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80668566 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 301 (S301G)
Ref Sequence ENSEMBL: ENSMUSP00000143508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003433] [ENSMUST00000197276] [ENSMUST00000198819] [ENSMUST00000199949] [ENSMUST00000200082]
AlphaFold Q8CDB0
Predicted Effect probably benign
Transcript: ENSMUST00000003433
AA Change: S254G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000003433
Gene: ENSMUSG00000020190
AA Change: S254G

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
S_TKc 36 321 7.09e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197276
SMART Domains Protein: ENSMUSP00000143679
Gene: ENSMUSG00000020190

DomainStartEndE-ValueType
SCOP:d1koba_ 52 118 3e-11 SMART
PDB:2AC3|A 59 118 3e-32 PDB
Blast:S_TKc 71 118 1e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198819
Predicted Effect probably benign
Transcript: ENSMUST00000199949
Predicted Effect probably benign
Transcript: ENSMUST00000200082
AA Change: S301G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000143508
Gene: ENSMUSG00000020190
AA Change: S301G

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
S_TKc 83 368 7.09e-88 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Mknk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Mknk2 APN 10 80667664 splice site probably benign
IGL02471:Mknk2 APN 10 80668121 missense probably damaging 0.99
IGL02643:Mknk2 APN 10 80668601 missense probably damaging 1.00
H8562:Mknk2 UTSW 10 80668934 splice site probably benign
IGL03052:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R0645:Mknk2 UTSW 10 80671908 splice site probably null
R2061:Mknk2 UTSW 10 80671557 critical splice donor site probably null
R2105:Mknk2 UTSW 10 80668601 missense possibly damaging 0.90
R2167:Mknk2 UTSW 10 80668701 missense probably damaging 1.00
R3847:Mknk2 UTSW 10 80667975 nonsense probably null
R4649:Mknk2 UTSW 10 80669339 missense probably damaging 1.00
R5062:Mknk2 UTSW 10 80671769 missense probably damaging 1.00
R5358:Mknk2 UTSW 10 80671763 missense probably benign 0.19
R5433:Mknk2 UTSW 10 80667225 missense probably benign 0.00
R5518:Mknk2 UTSW 10 80668641 missense possibly damaging 0.92
R5813:Mknk2 UTSW 10 80675862 missense probably benign 0.34
R6060:Mknk2 UTSW 10 80671634 missense probably benign 0.00
R6151:Mknk2 UTSW 10 80669025 splice site probably null
R6366:Mknk2 UTSW 10 80671933 missense probably damaging 0.99
R7827:Mknk2 UTSW 10 80667187 missense probably benign 0.03
R7943:Mknk2 UTSW 10 80675867 missense probably benign 0.00
R8075:Mknk2 UTSW 10 80672148 intron probably benign
R9114:Mknk2 UTSW 10 80668989 missense probably damaging 1.00
R9140:Mknk2 UTSW 10 80671593 missense probably benign 0.22
R9451:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R9506:Mknk2 UTSW 10 80668084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAGATGCCTAAGGAGGGTG -3'
(R):5'- GGCATCCCTTCTGACTTGTG -3'

Sequencing Primer
(F):5'- AGAGGACCACGGTTTCATTC -3'
(R):5'- GACTTGTGCCTGCCCTG -3'
Posted On 2019-10-24