Incidental Mutation 'R7395:Tph1'
ID605544
Institutional Source Beutler Lab
Gene Symbol Tph1
Ensembl Gene ENSMUSG00000040046
Gene Nametryptophan hydroxylase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R7395 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46644641-46672537 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 46657203 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049298] [ENSMUST00000107669] [ENSMUST00000168335] [ENSMUST00000170251]
Predicted Effect probably null
Transcript: ENSMUST00000049298
SMART Domains Protein: ENSMUSP00000037752
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 4.3e-8 PFAM
Pfam:Biopterin_H 109 440 4.7e-188 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107669
SMART Domains Protein: ENSMUSP00000103296
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:Biopterin_H 109 439 7.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168335
SMART Domains Protein: ENSMUSP00000128107
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 3.7e-9 PFAM
Pfam:Biopterin_H 109 149 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170251
SMART Domains Protein: ENSMUSP00000132489
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 6.7e-8 PFAM
Pfam:Biopterin_H 109 279 3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172386
SMART Domains Protein: ENSMUSP00000128727
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 17 82 6.9e-9 PFAM
Pfam:Biopterin_H 105 164 8.9e-24 PFAM
low complexity region 175 188 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one null allele display no gross behavioral abnormalities. Mice homozygous for a second null allele display fatigue, breathing difficulties, progressive pallor, and impaired cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Tph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Tph1 APN 7 46656870 missense probably benign 0.02
IGL01318:Tph1 APN 7 46665238 missense probably damaging 0.99
IGL01538:Tph1 APN 7 46653753 missense probably damaging 1.00
IGL01564:Tph1 APN 7 46650881 splice site probably benign
IGL02021:Tph1 APN 7 46656997 missense possibly damaging 0.55
IGL02202:Tph1 APN 7 46653761 missense probably benign 0.40
IGL03072:Tph1 APN 7 46652859 missense probably damaging 0.99
I1329:Tph1 UTSW 7 46650013 missense probably damaging 0.99
R0166:Tph1 UTSW 7 46647596 missense probably damaging 1.00
R0433:Tph1 UTSW 7 46653821 missense probably damaging 1.00
R0485:Tph1 UTSW 7 46650024 missense probably benign 0.00
R0501:Tph1 UTSW 7 46649988 nonsense probably null
R1456:Tph1 UTSW 7 46647483 nonsense probably null
R1474:Tph1 UTSW 7 46653862 missense probably benign 0.00
R1846:Tph1 UTSW 7 46660439 missense probably damaging 0.98
R1967:Tph1 UTSW 7 46662114 missense probably benign 0.30
R2102:Tph1 UTSW 7 46660410 splice site probably null
R2176:Tph1 UTSW 7 46662039 missense possibly damaging 0.91
R2225:Tph1 UTSW 7 46665174 critical splice donor site probably null
R4773:Tph1 UTSW 7 46656952 missense probably damaging 1.00
R4914:Tph1 UTSW 7 46653859 missense probably damaging 1.00
R5590:Tph1 UTSW 7 46653792 missense probably damaging 1.00
R5622:Tph1 UTSW 7 46647545 nonsense probably null
R5960:Tph1 UTSW 7 46662005 critical splice donor site probably null
R5985:Tph1 UTSW 7 46653781 missense probably damaging 1.00
R6362:Tph1 UTSW 7 46647443 missense possibly damaging 0.94
R7151:Tph1 UTSW 7 46662117 missense possibly damaging 0.93
R7329:Tph1 UTSW 7 46656861 splice site probably null
R8012:Tph1 UTSW 7 46656879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAATCTTGGGAATGGGGTCC -3'
(R):5'- GTCTGCTGGCTTCAAAATAAAAGC -3'

Sequencing Primer
(F):5'- TCCCCACTGAGGAGATGGAGAC -3'
(R):5'- GCAGTCACATTTCTCTAAGCAATC -3'
Posted On2019-12-13