Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Stag3'

573726

Institutional Source

Beutler Lab

Gene Symbol

Stag3

Ensembl Gene

ENSMUSG00000036928

Gene Name

stromal antigen 3

Synonyms

SA-2, stromalin 3

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

138280240-138312393 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 138281945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 24 (Q24L)

Ref Sequence

ENSEMBL: ENSMUSP00000040945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014089] [ENSMUST00000048028] [ENSMUST00000159067] [ENSMUST00000160729] [ENSMUST00000161691] [ENSMUST00000161827] [ENSMUST00000161984] [ENSMUST00000162245]

AlphaFold

O70576

Predicted Effect

probably benign
Transcript: ENSMUST00000014089

SMART Domains

Protein: ENSMUSP00000014089
Gene: ENSMUSG00000029510

Domain	Start	End	E-Value	Type
Pfam:Glypican	7	560	2.8e-186	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000048028
AA Change: Q24L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: Q24L

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
Pfam:STAG	188	301	3.1e-38	PFAM
low complexity region	633	653	N/A	INTRINSIC
low complexity region	1099	1114	N/A	INTRINSIC
low complexity region	1141	1151	N/A	INTRINSIC
low complexity region	1190	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159067

SMART Domains

Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

Domain	Start	End	E-Value	Type
Pfam:Glypican	7	250	1e-90	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160729
AA Change: Q24L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928
AA Change: Q24L

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161691

SMART Domains

Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

Domain	Start	End	E-Value	Type
low complexity region	44	59	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161827

SMART Domains

Protein: ENSMUSP00000124459
Gene: ENSMUSG00000029510

Domain	Start	End	E-Value	Type
Pfam:Glypican	11	566	3.1e-199	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161984

SMART Domains

Protein: ENSMUSP00000137879
Gene: ENSMUSG00000029510

Domain	Start	End	E-Value	Type
Pfam:Glypican	7	342	3.7e-134	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162245
AA Change: Q24L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: Q24L

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
Pfam:STAG	185	304	4e-50	PFAM
low complexity region	633	653	N/A	INTRINSIC
low complexity region	1099	1114	N/A	INTRINSIC
low complexity region	1141	1151	N/A	INTRINSIC
low complexity region	1190	1208	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Stag3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Stag3	APN	5	138299138	missense	probably damaging	1.00
IGL00336:Stag3	APN	5	138297659	missense	probably benign	0.42
IGL00514:Stag3	APN	5	138300135	missense	probably damaging	1.00
IGL00961:Stag3	APN	5	138298349	missense	probably benign	0.01
IGL01923:Stag3	APN	5	138289230	missense	probably damaging	1.00
IGL02252:Stag3	APN	5	138302548	missense	probably damaging	1.00
IGL02424:Stag3	APN	5	138281985	nonsense	probably null
IGL02424:Stag3	APN	5	138291366	missense	probably damaging	1.00
IGL02869:Stag3	APN	5	138282693	missense	probably damaging	0.96
thor	UTSW	5	138301036	critical splice donor site	probably null
R0016:Stag3	UTSW	5	138291381	missense	possibly damaging	0.50
R0038:Stag3	UTSW	5	138301036	critical splice donor site	probably null
R0038:Stag3	UTSW	5	138301036	critical splice donor site	probably null
R0046:Stag3	UTSW	5	138283023	splice site	probably benign
R0046:Stag3	UTSW	5	138283023	splice site	probably benign
R1455:Stag3	UTSW	5	138311735	missense	probably benign	0.00
R1512:Stag3	UTSW	5	138297985	missense	probably benign	0.32
R1530:Stag3	UTSW	5	138297412	missense	probably damaging	0.99
R1608:Stag3	UTSW	5	138298639	splice site	probably null
R1736:Stag3	UTSW	5	138304509	splice site	probably benign
R1969:Stag3	UTSW	5	138300138	missense	probably damaging	0.99
R2034:Stag3	UTSW	5	138298001	missense	possibly damaging	0.82
R2214:Stag3	UTSW	5	138301266	missense	possibly damaging	0.92
R2281:Stag3	UTSW	5	138298284	missense	probably damaging	1.00
R2411:Stag3	UTSW	5	138283028	splice site	probably benign
R3792:Stag3	UTSW	5	138298349	missense	probably benign	0.01
R3887:Stag3	UTSW	5	138298839	missense	probably damaging	0.99
R4255:Stag3	UTSW	5	138290881	missense	probably damaging	0.98
R4777:Stag3	UTSW	5	138309199	unclassified	probably benign
R4842:Stag3	UTSW	5	138309365	splice site	probably null
R4854:Stag3	UTSW	5	138296694	splice site	probably null
R5045:Stag3	UTSW	5	138304478	missense	probably damaging	1.00
R5631:Stag3	UTSW	5	138295877	missense	probably damaging	0.96
R5729:Stag3	UTSW	5	138290223	missense	possibly damaging	0.76
R5894:Stag3	UTSW	5	138298838	missense	probably damaging	0.99
R6004:Stag3	UTSW	5	138289206	missense	probably damaging	1.00
R6172:Stag3	UTSW	5	138299843	missense	probably benign	0.41
R6503:Stag3	UTSW	5	138304420	missense	probably damaging	0.96
R6545:Stag3	UTSW	5	138298352	missense	possibly damaging	0.84
R6736:Stag3	UTSW	5	138301499	missense	probably damaging	0.98
R6861:Stag3	UTSW	5	138304707	missense	possibly damaging	0.55
R7012:Stag3	UTSW	5	138297609	splice site	probably null
R7358:Stag3	UTSW	5	138301508	missense	probably damaging	1.00
R7378:Stag3	UTSW	5	138281960	missense	probably benign	0.00
R7392:Stag3	UTSW	5	138291366	missense	probably damaging	1.00
R7818:Stag3	UTSW	5	138301443	missense	probably benign	0.00
R8017:Stag3	UTSW	5	138301203	missense	possibly damaging	0.80
R8019:Stag3	UTSW	5	138301203	missense	possibly damaging	0.80
R8076:Stag3	UTSW	5	138283142	missense	probably damaging	0.96
R8393:Stag3	UTSW	5	138296755	missense	probably damaging	0.98
R8405:Stag3	UTSW	5	138304652	missense	probably damaging	0.99
R8417:Stag3	UTSW	5	138308588	missense	probably benign
R8734:Stag3	UTSW	5	138311788	missense	probably benign	0.36
R8848:Stag3	UTSW	5	138290266	missense	probably null	0.97
R8966:Stag3	UTSW	5	138291404	missense	probably damaging	0.99
R9029:Stag3	UTSW	5	138298034	missense	probably damaging	1.00
R9292:Stag3	UTSW	5	138301450	missense	probably benign	0.01
R9410:Stag3	UTSW	5	138299339	missense	possibly damaging	0.95
R9645:Stag3	UTSW	5	138301439	missense	possibly damaging	0.78
R9723:Stag3	UTSW	5	138299841	missense	probably benign
Z1177:Stag3	UTSW	5	138301292	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- ACCTCGATGTGGTTAGGTTGAC -3'
(R):5'- TGTCATATGGCCCCACATACAC -3'

Sequencing Primer
(F):5'- GGTGCTCTATCCCATAGTACTGAGAC -3'
(R):5'- TACAACCATGCTAGAAAACAACAGAG -3'

Posted On

2019-09-13