Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Lrig2'

573713

Institutional Source

Beutler Lab

Gene Symbol

Lrig2

Ensembl Gene

ENSMUSG00000032913

Gene Name

leucine-rich repeats and immunoglobulin-like domains 2

Synonyms

4632419I10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104396418-104511918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104497520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 91 (N91D)

Ref Sequence

ENSEMBL: ENSMUSP00000035999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]

AlphaFold

Q52KR2

Predicted Effect

probably benign
Transcript: ENSMUST00000046316
AA Change: N91D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: N91D

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
low complexity region	68	82	N/A	INTRINSIC
LRR	118	141	3.56e2	SMART
LRR	142	165	1.81e2	SMART
LRR	167	188	1.31e0	SMART
LRR	213	236	1.41e0	SMART
LRR	237	260	4.98e-1	SMART
LRR	261	284	1.49e1	SMART
LRR	285	308	1.62e0	SMART
LRR	309	332	2.14e0	SMART
LRR_TYP	333	356	2.2e-2	SMART
LRR	357	383	9.22e0	SMART
LRR	384	407	2.17e-1	SMART
LRR_TYP	408	431	3.95e-4	SMART
LRRCT	442	492	3.62e-8	SMART
IG	503	598	2.19e-9	SMART
IGc2	613	681	1.94e-10	SMART
IGc2	707	772	3.2e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198332
AA Change: N91D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: N91D

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
low complexity region	68	82	N/A	INTRINSIC
LRR	118	141	3.56e2	SMART
LRR	142	165	1.81e2	SMART
LRR	167	188	1.31e0	SMART
LRR	213	236	1.41e0	SMART
LRR	237	260	4.98e-1	SMART
LRR	261	284	1.49e1	SMART
LRR	285	308	1.62e0	SMART
LRR	309	332	2.14e0	SMART
LRR_TYP	333	356	2.2e-2	SMART
LRR	357	383	9.22e0	SMART
LRR	384	407	2.17e-1	SMART
LRR_TYP	408	431	3.95e-4	SMART
LRRCT	442	492	3.62e-8	SMART
IG	503	598	2.19e-9	SMART
IGc2	613	681	1.94e-10	SMART
IGc2	707	772	3.2e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000199070

SMART Domains

Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
LRRCT	84	134	1.8e-10	SMART
IG	145	240	9.2e-12	SMART
IGc2	255	323	8.1e-13	SMART
IGc2	349	414	1.3e-13	SMART
transmembrane domain	447	469	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Lrig2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Lrig2	APN	3	104467171	missense	probably damaging	0.99
IGL00715:Lrig2	APN	3	104463948	missense	probably damaging	1.00
IGL01105:Lrig2	APN	3	104464168	nonsense	probably null
IGL01767:Lrig2	APN	3	104491545	missense	probably benign	0.12
IGL02080:Lrig2	APN	3	104464124	missense	probably damaging	1.00
IGL02088:Lrig2	APN	3	104467108	missense	probably damaging	1.00
IGL02967:Lrig2	APN	3	104494196	intron	probably benign
IGL03024:Lrig2	APN	3	104494073	missense	probably damaging	1.00
IGL03079:Lrig2	APN	3	104490971	missense	probably damaging	0.98
IGL03085:Lrig2	APN	3	104467259	missense	probably damaging	1.00
IGL03162:Lrig2	APN	3	104464297	missense	probably damaging	1.00
Belladonna	UTSW	3	104467366	splice site	probably benign
R0414:Lrig2	UTSW	3	104494056	critical splice donor site	probably null
R0866:Lrig2	UTSW	3	104464275	missense	probably benign	0.00
R1184:Lrig2	UTSW	3	104490911	missense	possibly damaging	0.94
R1524:Lrig2	UTSW	3	104463876	missense	probably benign	0.38
R1606:Lrig2	UTSW	3	104480107	critical splice donor site	probably null
R1672:Lrig2	UTSW	3	104491812	missense	probably damaging	1.00
R1701:Lrig2	UTSW	3	104494677	missense	probably benign	0.02
R1778:Lrig2	UTSW	3	104467366	splice site	probably benign
R2034:Lrig2	UTSW	3	104494092	missense	probably benign
R2100:Lrig2	UTSW	3	104511630	missense	possibly damaging	0.76
R2186:Lrig2	UTSW	3	104468598	missense	probably benign	0.00
R3778:Lrig2	UTSW	3	104457961	missense	probably benign
R3977:Lrig2	UTSW	3	104457844	missense	probably damaging	1.00
R4119:Lrig2	UTSW	3	104467195	missense	probably benign	0.00
R4210:Lrig2	UTSW	3	104467304	missense	probably benign	0.00
R4612:Lrig2	UTSW	3	104462783	missense	probably damaging	1.00
R4872:Lrig2	UTSW	3	104491526	missense	possibly damaging	0.66
R5020:Lrig2	UTSW	3	104457901	missense	possibly damaging	0.71
R5499:Lrig2	UTSW	3	104461557	missense	probably benign	0.00
R5687:Lrig2	UTSW	3	104464072	splice site	probably null
R5718:Lrig2	UTSW	3	104468615	nonsense	probably null
R5886:Lrig2	UTSW	3	104462698	missense	probably benign	0.01
R5921:Lrig2	UTSW	3	104462754	nonsense	probably null
R6434:Lrig2	UTSW	3	104491547	missense	possibly damaging	0.91
R6468:Lrig2	UTSW	3	104467193	missense	probably damaging	1.00
R6513:Lrig2	UTSW	3	104465729	missense	probably damaging	1.00
R6675:Lrig2	UTSW	3	104457935	missense	probably benign	0.35
R7243:Lrig2	UTSW	3	104497567	splice site	probably null
R7444:Lrig2	UTSW	3	104497513	nonsense	probably null
R7514:Lrig2	UTSW	3	104465760	missense	probably damaging	1.00
R7751:Lrig2	UTSW	3	104494669	nonsense	probably null
R8720:Lrig2	UTSW	3	104511682	missense	probably damaging	0.99
R8809:Lrig2	UTSW	3	104461677	missense	probably benign	0.00
R9019:Lrig2	UTSW	3	104461598	missense	probably benign	0.27
R9204:Lrig2	UTSW	3	104480122	missense	possibly damaging	0.81
R9215:Lrig2	UTSW	3	104491008	missense	probably benign	0.00
R9549:Lrig2	UTSW	3	104490875	missense	probably damaging	0.97
R9562:Lrig2	UTSW	3	104468608	missense	possibly damaging	0.69
R9664:Lrig2	UTSW	3	104464240	missense	probably damaging	1.00
R9773:Lrig2	UTSW	3	104461522	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CTAAATGTTAATCTCTGGACTCCAC -3'
(R):5'- ACCTTTGTAGGACTTAGTATTCCTG -3'

Sequencing Primer
(F):5'- TGTTAATCTCTGGACTCCACAAGAAC -3'
(R):5'- TTCTCCTCCCTTCTAGAGCACAC -3'

Posted On

2019-09-13