Incidental Mutation 'R7395:Lrig2'
ID573713
Institutional Source Beutler Lab
Gene Symbol Lrig2
Ensembl Gene ENSMUSG00000032913
Gene Nameleucine-rich repeats and immunoglobulin-like domains 2
Synonyms4632419I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7395 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104396418-104511918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104497520 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 91 (N91D)
Ref Sequence ENSEMBL: ENSMUSP00000035999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]
Predicted Effect probably benign
Transcript: ENSMUST00000046316
AA Change: N91D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: N91D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198332
AA Change: N91D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: N91D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199070
SMART Domains Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
LRRCT 84 134 1.8e-10 SMART
IG 145 240 9.2e-12 SMART
IGc2 255 323 8.1e-13 SMART
IGc2 349 414 1.3e-13 SMART
transmembrane domain 447 469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Lrig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Lrig2 APN 3 104467171 missense probably damaging 0.99
IGL00715:Lrig2 APN 3 104463948 missense probably damaging 1.00
IGL01105:Lrig2 APN 3 104464168 nonsense probably null
IGL01767:Lrig2 APN 3 104491545 missense probably benign 0.12
IGL02080:Lrig2 APN 3 104464124 missense probably damaging 1.00
IGL02088:Lrig2 APN 3 104467108 missense probably damaging 1.00
IGL02967:Lrig2 APN 3 104494196 intron probably benign
IGL03024:Lrig2 APN 3 104494073 missense probably damaging 1.00
IGL03079:Lrig2 APN 3 104490971 missense probably damaging 0.98
IGL03085:Lrig2 APN 3 104467259 missense probably damaging 1.00
IGL03162:Lrig2 APN 3 104464297 missense probably damaging 1.00
Belladonna UTSW 3 104467366 splice site probably benign
R0414:Lrig2 UTSW 3 104494056 critical splice donor site probably null
R0866:Lrig2 UTSW 3 104464275 missense probably benign 0.00
R1184:Lrig2 UTSW 3 104490911 missense possibly damaging 0.94
R1524:Lrig2 UTSW 3 104463876 missense probably benign 0.38
R1606:Lrig2 UTSW 3 104480107 critical splice donor site probably null
R1672:Lrig2 UTSW 3 104491812 missense probably damaging 1.00
R1701:Lrig2 UTSW 3 104494677 missense probably benign 0.02
R1778:Lrig2 UTSW 3 104467366 splice site probably benign
R2034:Lrig2 UTSW 3 104494092 missense probably benign
R2100:Lrig2 UTSW 3 104511630 missense possibly damaging 0.76
R2186:Lrig2 UTSW 3 104468598 missense probably benign 0.00
R3778:Lrig2 UTSW 3 104457961 missense probably benign
R3977:Lrig2 UTSW 3 104457844 missense probably damaging 1.00
R4119:Lrig2 UTSW 3 104467195 missense probably benign 0.00
R4210:Lrig2 UTSW 3 104467304 missense probably benign 0.00
R4612:Lrig2 UTSW 3 104462783 missense probably damaging 1.00
R4872:Lrig2 UTSW 3 104491526 missense possibly damaging 0.66
R5020:Lrig2 UTSW 3 104457901 missense possibly damaging 0.71
R5499:Lrig2 UTSW 3 104461557 missense probably benign 0.00
R5687:Lrig2 UTSW 3 104464072 splice site probably null
R5718:Lrig2 UTSW 3 104468615 nonsense probably null
R5886:Lrig2 UTSW 3 104462698 missense probably benign 0.01
R5921:Lrig2 UTSW 3 104462754 nonsense probably null
R6434:Lrig2 UTSW 3 104491547 missense possibly damaging 0.91
R6468:Lrig2 UTSW 3 104467193 missense probably damaging 1.00
R6513:Lrig2 UTSW 3 104465729 missense probably damaging 1.00
R6675:Lrig2 UTSW 3 104457935 missense probably benign 0.35
R7243:Lrig2 UTSW 3 104497567 splice site probably null
R7444:Lrig2 UTSW 3 104497513 nonsense probably null
R7514:Lrig2 UTSW 3 104465760 missense probably damaging 1.00
R7751:Lrig2 UTSW 3 104494669 nonsense probably null
R8720:Lrig2 UTSW 3 104511682 missense probably damaging 0.99
R8809:Lrig2 UTSW 3 104461677 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAAATGTTAATCTCTGGACTCCAC -3'
(R):5'- ACCTTTGTAGGACTTAGTATTCCTG -3'

Sequencing Primer
(F):5'- TGTTAATCTCTGGACTCCACAAGAAC -3'
(R):5'- TTCTCCTCCCTTCTAGAGCACAC -3'
Posted On2019-09-13