Incidental Mutation 'R8031:Sacs'
ID 617976
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Name sacsin
Synonyms E130115J16Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8031 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 61138457-61240695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 61204191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1229 (H1229Y)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119943
AA Change: H1229Y

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: H1229Y

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
BB009:Sacs UTSW 14 61204878 missense probably damaging 0.99
BB019:Sacs UTSW 14 61204878 missense probably damaging 0.99
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 splice site probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 splice site probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 splice site probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
R7023:Sacs UTSW 14 61208815 missense probably benign 0.04
R7047:Sacs UTSW 14 61213002 missense probably damaging 1.00
R7051:Sacs UTSW 14 61208928 missense probably benign 0.25
R7069:Sacs UTSW 14 61212496 missense probably damaging 1.00
R7082:Sacs UTSW 14 61210517 missense possibly damaging 0.94
R7108:Sacs UTSW 14 61211009 nonsense probably null
R7122:Sacs UTSW 14 61210396 missense probably damaging 1.00
R7194:Sacs UTSW 14 61210089 missense possibly damaging 0.95
R7214:Sacs UTSW 14 61191792 missense probably benign
R7221:Sacs UTSW 14 61208806 missense probably damaging 0.99
R7274:Sacs UTSW 14 61214081 missense possibly damaging 0.88
R7344:Sacs UTSW 14 61207444 missense possibly damaging 0.81
R7440:Sacs UTSW 14 61191605 missense probably benign 0.10
R7474:Sacs UTSW 14 61211178 missense probably benign 0.04
R7512:Sacs UTSW 14 61204430 missense probably benign 0.04
R7641:Sacs UTSW 14 61202871 missense probably damaging 0.97
R7649:Sacs UTSW 14 61203228 missense possibly damaging 0.53
R7703:Sacs UTSW 14 61206090 missense possibly damaging 0.81
R7792:Sacs UTSW 14 61209773 missense probably benign 0.00
R7805:Sacs UTSW 14 61203591 missense not run
R7822:Sacs UTSW 14 61192203 missense probably benign 0.03
R7882:Sacs UTSW 14 61207071 missense probably benign 0.02
R7932:Sacs UTSW 14 61204878 missense probably damaging 0.99
R8064:Sacs UTSW 14 61192175 missense possibly damaging 0.92
R8083:Sacs UTSW 14 61210717 missense possibly damaging 0.77
R8204:Sacs UTSW 14 61212948 missense probably damaging 0.96
R8293:Sacs UTSW 14 61191099 missense probably damaging 0.99
R8316:Sacs UTSW 14 61189619 missense possibly damaging 0.84
R8393:Sacs UTSW 14 61173206 start codon destroyed probably null 0.06
R8434:Sacs UTSW 14 61213187 nonsense probably null
R8482:Sacs UTSW 14 61202955 missense probably benign
R8497:Sacs UTSW 14 61192253 missense probably benign 0.00
R8557:Sacs UTSW 14 61207276 missense probably damaging 1.00
R8698:Sacs UTSW 14 61213353 missense probably benign
R8840:Sacs UTSW 14 61191728 missense probably benign 0.25
R8924:Sacs UTSW 14 61192446 missense probably benign 0.22
R8924:Sacs UTSW 14 61211253 missense probably damaging 1.00
R8941:Sacs UTSW 14 61192573 missense probably benign 0.00
R9007:Sacs UTSW 14 61207736 missense probably benign 0.04
R9008:Sacs UTSW 14 61204543 missense probably benign 0.19
R9070:Sacs UTSW 14 61210302 missense probably benign
R9147:Sacs UTSW 14 61212688 missense possibly damaging 0.86
R9185:Sacs UTSW 14 61206666 missense probably damaging 0.98
R9290:Sacs UTSW 14 61184050 missense probably benign 0.17
R9294:Sacs UTSW 14 61240319 missense possibly damaging 0.84
R9339:Sacs UTSW 14 61205860 missense probably benign 0.00
R9341:Sacs UTSW 14 61208770 missense probably benign 0.08
R9343:Sacs UTSW 14 61208770 missense probably benign 0.08
R9370:Sacs UTSW 14 61203631 missense probably damaging 1.00
R9433:Sacs UTSW 14 61206548 missense probably damaging 1.00
R9460:Sacs UTSW 14 61204162 missense probably benign 0.34
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Z1176:Sacs UTSW 14 61210830 nonsense probably null
Z1176:Sacs UTSW 14 61213200 missense probably damaging 1.00
Z1177:Sacs UTSW 14 61191551 missense possibly damaging 0.48
Z1177:Sacs UTSW 14 61207981 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GACCTCCAAATTATCCCGGTTC -3'
(R):5'- TGGGTTGGCTTTATCACAGC -3'

Sequencing Primer
(F):5'- ATCCCGGTTCCTTAGTCTGGAAAG -3'
(R):5'- TTTATCACAGCCTGGGCAAG -3'
Posted On 2020-01-23