Incidental Mutation 'R8031:Top2b'
ID617974
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R8031 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16412986 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 965 (D965G)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: D965G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: D965G

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485
AA Change: D107G

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Kcnt1 C A 2: 25,908,042 probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Spink5 T A 18: 44,010,236 D753E probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAACCTGCATATTGTATGGC -3'
(R):5'- AGCATTCAAGTTCATTGTTGTGGC -3'

Sequencing Primer
(F):5'- GTATGGCTTTTCTCACCATCAAGG -3'
(R):5'- AAAAACTTTATGCAGGCCA -3'
Posted On2020-01-23