Incidental Mutation 'R8031:Spink5'
ID617987
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8031 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44010236 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 753 (D753E)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably benign
Transcript: ENSMUST00000069245
AA Change: D753E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: D753E

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,998,098 probably null Het
Arhgdib A G 6: 136,924,276 Y152H probably benign Het
Atxn10 T G 15: 85,393,393 S354A probably benign Het
Cacng6 T C 7: 3,424,885 V75A possibly damaging Het
Cdc23 A G 18: 34,651,688 V7A unknown Het
Cdc40 T A 10: 40,852,516 E157D probably benign Het
Defa25 T A 8: 21,085,237 N77K probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Efcab6 T C 15: 83,983,498 K260E possibly damaging Het
Eif4a3 T C 11: 119,288,905 Y352C probably damaging Het
Erc2 A T 14: 28,011,692 K566N probably damaging Het
Fam3b A C 16: 97,481,852 Y74* probably null Het
Flg2 T A 3: 93,220,214 S2144R unknown Het
Fmo4 G T 1: 162,798,852 S375* probably null Het
Fsip2 A G 2: 82,986,891 T4323A probably benign Het
Gm11639 T C 11: 104,881,469 V2659A possibly damaging Het
Gm16503 A T 4: 147,541,310 H87L unknown Het
Hes7 C T 11: 69,122,765 A150V probably damaging Het
Hk1 T A 10: 62,296,699 N190I probably benign Het
Il17rc A G 6: 113,482,821 D576G probably damaging Het
Inhba T A 13: 16,026,275 S141T possibly damaging Het
Itga8 G T 2: 12,155,486 D840E probably benign Het
Kazn T C 4: 142,154,551 E126G Het
Kcnk13 A G 12: 99,966,179 Y78C probably damaging Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Myo9a A G 9: 59,780,091 K160E probably benign Het
Nlrp1b T C 11: 71,216,921 R585G probably benign Het
Ntrk2 T C 13: 58,874,379 I416T probably benign Het
Olfr1080 G A 2: 86,554,103 T7I probably damaging Het
Olfr1217 A T 2: 89,023,628 I125N probably damaging Het
Olfr177 T C 16: 58,872,691 N153S probably benign Het
Olfr652 T A 7: 104,565,109 I296N probably damaging Het
P4ha3 A G 7: 100,292,698 E106G probably damaging Het
Pcif1 A G 2: 164,886,522 N233S probably damaging Het
Pgm2l1 C A 7: 100,272,418 R619S probably damaging Het
Pkhd1l1 A G 15: 44,512,834 Q964R probably damaging Het
Pla2g4a T A 1: 149,901,213 I89F possibly damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Psmd4 T C 3: 95,035,892 D67G probably damaging Het
Ptprt G A 2: 162,135,457 T307I probably damaging Het
Rnf213 C A 11: 119,430,281 C1188* probably null Het
Ror2 C T 13: 53,113,157 C426Y probably damaging Het
Sacs C T 14: 61,204,191 H1229Y probably damaging Het
Slc25a25 A T 2: 32,421,505 L118Q probably damaging Het
Slc38a6 G A 12: 73,350,603 A340T probably benign Het
Smarca5 A T 8: 80,704,682 Y969N probably damaging Het
Sorbs1 C A 19: 40,326,489 M626I probably benign Het
Taf1d T G 9: 15,310,399 I226S probably damaging Het
Tmem225 A G 9: 40,149,393 I83V possibly damaging Het
Top2b A G 14: 16,412,986 D965G probably damaging Het
Traf3ip1 A G 1: 91,501,419 K303E probably damaging Het
Ube2n C T 10: 95,541,382 R70C probably benign Het
Ubl7 C T 9: 57,923,206 P312S probably damaging Het
Vmn1r34 A T 6: 66,637,181 M191K probably damaging Het
Vmn2r103 C T 17: 19,793,497 H184Y probably benign Het
Vmn2r104 T C 17: 20,042,786 I138V probably benign Het
Vmn2r49 T C 7: 9,986,481 E361G possibly damaging Het
Vmn2r78 T C 7: 86,954,867 L751P probably damaging Het
Zc3h13 T A 14: 75,330,630 I1121N not run Het
Zfp235 T A 7: 24,141,689 V511E probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R7919:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7963:Spink5 UTSW 18 43986326 missense probably benign 0.40
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAACAGAGGTTGGGC -3'
(R):5'- ATTAGAACCACCTCGTTCACTG -3'

Sequencing Primer
(F):5'- ACAGAGGTTGGGCTGGGG -3'
(R):5'- TGGTCCAGCCATGACTCC -3'
Posted On2020-01-23