Mutagenetix > Incidental Mutations

Incidental Mutation 'R8031:Spink5'

617987

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8031 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44010236 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 753 (D753E)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

Predicted Effect

probably benign
Transcript: ENSMUST00000069245
AA Change: D753E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: D753E

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace3	T	C	11: 105,998,098		probably null	Het
Arhgdib	A	G	6: 136,924,276	Y152H	probably benign	Het
Atxn10	T	G	15: 85,393,393	S354A	probably benign	Het
Cacng6	T	C	7: 3,424,885	V75A	possibly damaging	Het
Cdc23	A	G	18: 34,651,688	V7A	unknown	Het
Cdc40	T	A	10: 40,852,516	E157D	probably benign	Het
Defa25	T	A	8: 21,085,237	N77K	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Efcab6	T	C	15: 83,983,498	K260E	possibly damaging	Het
Eif4a3	T	C	11: 119,288,905	Y352C	probably damaging	Het
Erc2	A	T	14: 28,011,692	K566N	probably damaging	Het
Fam3b	A	C	16: 97,481,852	Y74*	probably null	Het
Flg2	T	A	3: 93,220,214	S2144R	unknown	Het
Fmo4	G	T	1: 162,798,852	S375*	probably null	Het
Fsip2	A	G	2: 82,986,891	T4323A	probably benign	Het
Gm11639	T	C	11: 104,881,469	V2659A	possibly damaging	Het
Gm16503	A	T	4: 147,541,310	H87L	unknown	Het
Hes7	C	T	11: 69,122,765	A150V	probably damaging	Het
Hk1	T	A	10: 62,296,699	N190I	probably benign	Het
Il17rc	A	G	6: 113,482,821	D576G	probably damaging	Het
Inhba	T	A	13: 16,026,275	S141T	possibly damaging	Het
Itga8	G	T	2: 12,155,486	D840E	probably benign	Het
Kazn	T	C	4: 142,154,551	E126G		Het
Kcnk13	A	G	12: 99,966,179	Y78C	probably damaging	Het
Kcnt1	C	A	2: 25,908,042		probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Myo9a	A	G	9: 59,780,091	K160E	probably benign	Het
Nlrp1b	T	C	11: 71,216,921	R585G	probably benign	Het
Ntrk2	T	C	13: 58,874,379	I416T	probably benign	Het
Olfr1080	G	A	2: 86,554,103	T7I	probably damaging	Het
Olfr1217	A	T	2: 89,023,628	I125N	probably damaging	Het
Olfr177	T	C	16: 58,872,691	N153S	probably benign	Het
Olfr652	T	A	7: 104,565,109	I296N	probably damaging	Het
P4ha3	A	G	7: 100,292,698	E106G	probably damaging	Het
Pcif1	A	G	2: 164,886,522	N233S	probably damaging	Het
Pgm2l1	C	A	7: 100,272,418	R619S	probably damaging	Het
Pkhd1l1	A	G	15: 44,512,834	Q964R	probably damaging	Het
Pla2g4a	T	A	1: 149,901,213	I89F	possibly damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Psmd4	T	C	3: 95,035,892	D67G	probably damaging	Het
Ptprt	G	A	2: 162,135,457	T307I	probably damaging	Het
Rnf213	C	A	11: 119,430,281	C1188*	probably null	Het
Ror2	C	T	13: 53,113,157	C426Y	probably damaging	Het
Sacs	C	T	14: 61,204,191	H1229Y	probably damaging	Het
Slc25a25	A	T	2: 32,421,505	L118Q	probably damaging	Het
Slc38a6	G	A	12: 73,350,603	A340T	probably benign	Het
Smarca5	A	T	8: 80,704,682	Y969N	probably damaging	Het
Sorbs1	C	A	19: 40,326,489	M626I	probably benign	Het
Taf1d	T	G	9: 15,310,399	I226S	probably damaging	Het
Tmem225	A	G	9: 40,149,393	I83V	possibly damaging	Het
Top2b	A	G	14: 16,412,986	D965G	probably damaging	Het
Traf3ip1	A	G	1: 91,501,419	K303E	probably damaging	Het
Ube2n	C	T	10: 95,541,382	R70C	probably benign	Het
Ubl7	C	T	9: 57,923,206	P312S	probably damaging	Het
Vmn1r34	A	T	6: 66,637,181	M191K	probably damaging	Het
Vmn2r103	C	T	17: 19,793,497	H184Y	probably benign	Het
Vmn2r104	T	C	17: 20,042,786	I138V	probably benign	Het
Vmn2r49	T	C	7: 9,986,481	E361G	possibly damaging	Het
Vmn2r78	T	C	7: 86,954,867	L751P	probably damaging	Het
Zc3h13	T	A	14: 75,330,630	I1121N	not run	Het
Zfp235	T	A	7: 24,141,689	V511E	probably benign	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999935	splice site	probably benign
R0079:Spink5	UTSW	18	43977764	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	43990672	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7332:Spink5	UTSW	18	43982250	missense	probably damaging	0.96
R7396:Spink5	UTSW	18	43977655	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8198:Spink5	UTSW	18	43992880	missense	probably benign	0.17
R8361:Spink5	UTSW	18	43989462	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	43990719	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44010238	missense	probably benign	0.02
R8749:Spink5	UTSW	18	43989358	nonsense	probably null
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAAAACAGAGGTTGGGC -3'
(R):5'- ATTAGAACCACCTCGTTCACTG -3'

Sequencing Primer
(F):5'- ACAGAGGTTGGGCTGGGG -3'
(R):5'- TGGTCCAGCCATGACTCC -3'

Posted On

2020-01-23