Incidental Mutation 'R8034:Faim'
ID618140
Institutional Source Beutler Lab
Gene Symbol Faim
Ensembl Gene ENSMUSG00000032463
Gene NameFas apoptotic inhibitory molecule
SynonymsFaim-L, Faim-S
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R8034 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location98986373-99002021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98992733 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000035038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035038] [ENSMUST00000112911] [ENSMUST00000185472]
PDB Structure
NMR Structure of FAIM-CTD [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035038
AA Change: V111A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035038
Gene: ENSMUSG00000032463
AA Change: V111A

DomainStartEndE-ValueType
Pfam:FAIM1 1 177 3e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112911
AA Change: V133A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108532
Gene: ENSMUSG00000032463
AA Change: V133A

DomainStartEndE-ValueType
Pfam:FAIM1 25 197 9.8e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185472
AA Change: V111A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140627
Gene: ENSMUSG00000032463
AA Change: V111A

DomainStartEndE-ValueType
Pfam:FAIM1 1 175 1.8e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene protects against death receptor-triggered apoptosis and regulates B-cell signaling and differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele have thymocytes with an enhanced susceptibility to FAS-induced apoptosis, and B cells that more susceptible to activation induced cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
BC067074 A T 13: 113,342,511 I1530F Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in Faim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Faim APN 9 98992165 missense probably damaging 1.00
IGL00783:Faim APN 9 98992165 missense probably damaging 1.00
IGL00784:Faim APN 9 98992165 missense probably damaging 1.00
IGL00785:Faim APN 9 98992165 missense probably damaging 1.00
IGL00786:Faim APN 9 98992165 missense probably damaging 1.00
IGL00809:Faim APN 9 98992165 missense probably damaging 1.00
IGL00811:Faim APN 9 98992165 missense probably damaging 1.00
IGL00813:Faim APN 9 98992165 missense probably damaging 1.00
IGL00814:Faim APN 9 98992165 missense probably damaging 1.00
IGL00815:Faim APN 9 98992165 missense probably damaging 1.00
IGL00816:Faim APN 9 98992165 missense probably damaging 1.00
IGL00817:Faim APN 9 98992165 missense probably damaging 1.00
IGL00821:Faim APN 9 98992165 missense probably damaging 1.00
IGL01330:Faim APN 9 98992535 missense probably damaging 1.00
IGL01925:Faim APN 9 98990919 unclassified probably benign
IGL02703:Faim APN 9 98992201 missense probably benign 0.09
R0638:Faim UTSW 9 98992096 splice site probably benign
R1251:Faim UTSW 9 98992634 missense probably damaging 0.99
R5476:Faim UTSW 9 98992729 missense probably damaging 1.00
R5901:Faim UTSW 9 98992142 missense probably benign 0.01
R6250:Faim UTSW 9 98992123 start codon destroyed probably benign 0.15
R7282:Faim UTSW 9 98992126 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGTTCTTTGTCGGAGCTGC -3'
(R):5'- TAGCAAACAGTCGATGCCTG -3'

Sequencing Primer
(F):5'- TCTTTGTCGGAGCTGCAAAAACC -3'
(R):5'- CAGTCGATGCCTGGATAGATATTAC -3'
Posted On2020-01-23