Mutagenetix > Incidental Mutation

Incidental Mutation 'R8320:Kif26b'

641887

Institutional Source

Beutler Lab

Gene Symbol

Kif26b

Ensembl Gene

ENSMUSG00000026494

Gene Name

kinesin family member 26B

Synonyms

D230039L06Rik, N-11 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8320 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

178529125-178939200 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 178884076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]

AlphaFold

Q7TNC6

Predicted Effect

probably benign
Transcript: ENSMUST00000160789

SMART Domains

Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494

Domain	Start	End	E-Value	Type
KISc	1	362	2.48e-42	SMART
low complexity region	363	375	N/A	INTRINSIC
low complexity region	402	416	N/A	INTRINSIC
low complexity region	460	466	N/A	INTRINSIC
low complexity region	560	600	N/A	INTRINSIC
low complexity region	652	662	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	1038	1048	N/A	INTRINSIC
low complexity region	1294	1322	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000161017

SMART Domains

Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494

Domain	Start	End	E-Value	Type
low complexity region	58	123	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	220	228	N/A	INTRINSIC
Blast:KISc	365	446	4e-8	BLAST
KISc	448	809	2.48e-42	SMART
low complexity region	810	822	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	907	913	N/A	INTRINSIC
low complexity region	1007	1047	N/A	INTRINSIC
low complexity region	1099	1109	N/A	INTRINSIC
low complexity region	1269	1288	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC
low complexity region	1741	1769	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb10	A	G	5: 24,537,628		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Clec3a	T	C	8: 114,425,629	V125A	probably benign	Het
Clspn	A	G	4: 126,563,950	D258G	possibly damaging	Het
Cnn3	T	G	3: 121,449,986	L32R	probably damaging	Het
Cntnap5a	T	C	1: 116,446,736	F993L	possibly damaging	Het
Cobl	A	G	11: 12,267,001	S496P	probably damaging	Het
Dmxl2	A	G	9: 54,383,759	V2469A	probably benign	Het
Dpcr1	T	C	17: 35,643,638	T11A	probably benign	Het
Egfr	T	C	11: 16,891,251	F714S	probably damaging	Het
Erap1	G	C	13: 74,666,549	E465Q	probably benign	Het
Ercc6	T	C	14: 32,521,015	V204A	probably benign	Het
Fbln2	C	T	6: 91,257,767	T689I	possibly damaging	Het
Fbxw13	G	T	9: 109,183,066	T311K	probably benign	Het
Foxj2	T	A	6: 122,833,690	S210T	probably benign	Het
Gnl1	A	G	17: 35,982,598	N225S	probably damaging	Het
Grid2	T	C	6: 63,256,933	I26T	probably benign	Het
Gzmd	A	G	14: 56,129,733	I234T	probably benign	Het
Igkv2-137	GA	GAA	6: 67,556,170		probably null	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Klra10	A	G	6: 130,269,248	C255R	probably damaging	Het
Lgi4	T	C	7: 31,068,941	V455A	probably benign	Het
Neb	C	A	2: 52,296,331	V910L	probably benign	Het
Pigg	G	A	5: 108,347,851	R918H	probably benign	Het
Poln	A	G	5: 34,149,827	V10A	possibly damaging	Het
Polr1a	T	A	6: 71,941,384	M642K	probably damaging	Het
Rasal1	C	T	5: 120,666,355	R431C	probably benign	Het
Rfc1	A	T	5: 65,303,036	Y167*	probably null	Het
Rnf17	TG	T	14: 56,424,542	132	probably null	Het
Sars2	C	T	7: 28,746,868	T174I	probably damaging	Het
Sept4	T	C	11: 87,589,734	V398A	possibly damaging	Het
Slc6a2	C	T	8: 92,992,848	T397I	probably benign	Het
Smarca4	G	T	9: 21,677,502	R1200L	probably benign	Het
Stx7	G	T	10: 24,179,148	A63S	probably damaging	Het
Sval3	G	A	6: 41,972,524	V99I	probably benign	Het
Syna	A	G	5: 134,559,720	I125T	possibly damaging	Het
Syne2	T	C	12: 76,103,830	S1827P	probably damaging	Het
Taf4b	T	C	18: 14,783,692	V33A	possibly damaging	Het
Tpcn2	C	T	7: 145,266,622	R373H	possibly damaging	Het
Trpm1	A	G	7: 64,268,793	D1511G	possibly damaging	Het
Ttc3	C	A	16: 94,418,676	R487S	probably damaging	Het
Tubb3	T	C	8: 123,420,855	S176P	possibly damaging	Het
Zfp189	C	G	4: 49,530,180	Q428E	probably benign	Het
Zscan4d	C	T	7: 11,066,015	V316M	probably benign	Het

Other mutations in Kif26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Kif26b	APN	1	178915648	missense	probably damaging	1.00
IGL00425:Kif26b	APN	1	178916301	missense	probably damaging	0.96
IGL00952:Kif26b	APN	1	178932205	missense	probably damaging	1.00
IGL01100:Kif26b	APN	1	178917244	missense	probably benign
IGL01347:Kif26b	APN	1	178870675	missense	probably damaging	1.00
IGL01543:Kif26b	APN	1	178678961	missense	probably benign	0.41
IGL01938:Kif26b	APN	1	178916038	missense	probably damaging	0.99
IGL02100:Kif26b	APN	1	178915947	missense	probably damaging	0.99
IGL02262:Kif26b	APN	1	178916068	missense	probably benign	0.05
IGL02576:Kif26b	APN	1	178916347	missense	probably benign
IGL02673:Kif26b	APN	1	178821605	missense	probably damaging	1.00
IGL03078:Kif26b	APN	1	178870726	missense	probably damaging	1.00
IGL03155:Kif26b	APN	1	178874128	missense	probably damaging	1.00
IGL03157:Kif26b	APN	1	178916365	missense	probably damaging	1.00
IGL03162:Kif26b	APN	1	178916932	missense	probably benign
IGL03220:Kif26b	APN	1	178864869	missense	probably damaging	1.00
IGL03299:Kif26b	APN	1	178821560	missense	probably benign	0.09
IGL03368:Kif26b	APN	1	178916208	missense	probably damaging	1.00
IGL03370:Kif26b	APN	1	178915381	missense	probably benign	0.39
PIT4449001:Kif26b	UTSW	1	178918086	missense	probably damaging	1.00
R0142:Kif26b	UTSW	1	178915389	missense	probably damaging	1.00
R0621:Kif26b	UTSW	1	178915653	missense	probably benign	0.02
R0987:Kif26b	UTSW	1	178821620	missense	probably damaging	1.00
R1107:Kif26b	UTSW	1	178917673	missense	probably benign	0.03
R1367:Kif26b	UTSW	1	178916463	missense	probably damaging	1.00
R1386:Kif26b	UTSW	1	178915644	missense	probably benign
R1619:Kif26b	UTSW	1	178916478	missense	probably benign	0.00
R1664:Kif26b	UTSW	1	178932139	missense	probably damaging	1.00
R2240:Kif26b	UTSW	1	178715923	missense	probably benign	0.00
R2264:Kif26b	UTSW	1	178928842	critical splice acceptor site	probably null
R2443:Kif26b	UTSW	1	178915014	missense	probably damaging	0.99
R3023:Kif26b	UTSW	1	178864868	missense	probably damaging	0.99
R3744:Kif26b	UTSW	1	178679030	missense	probably benign	0.00
R3831:Kif26b	UTSW	1	178916616	frame shift	probably null
R3832:Kif26b	UTSW	1	178916616	frame shift	probably null
R3833:Kif26b	UTSW	1	178916616	frame shift	probably null
R3843:Kif26b	UTSW	1	178928177	missense	probably damaging	1.00
R4108:Kif26b	UTSW	1	178916965	missense	possibly damaging	0.88
R4181:Kif26b	UTSW	1	178915426	missense	probably damaging	0.98
R4551:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4552:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4597:Kif26b	UTSW	1	178916793	missense	probably damaging	1.00
R4599:Kif26b	UTSW	1	178530459	missense	unknown
R4610:Kif26b	UTSW	1	178679355	missense	probably damaging	1.00
R4746:Kif26b	UTSW	1	178873981	nonsense	probably null
R4873:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R4875:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R5015:Kif26b	UTSW	1	178928330	missense	probably damaging	0.99
R5060:Kif26b	UTSW	1	178530630	missense	unknown
R5301:Kif26b	UTSW	1	178530668	missense	unknown
R5368:Kif26b	UTSW	1	178915884	missense	probably damaging	1.00
R5387:Kif26b	UTSW	1	178914876	missense	probably benign	0.01
R5589:Kif26b	UTSW	1	178916299	missense	probably benign	0.05
R6150:Kif26b	UTSW	1	178915546	missense	probably damaging	1.00
R6259:Kif26b	UTSW	1	178917405	missense	probably damaging	0.97
R6355:Kif26b	UTSW	1	178916178	missense	probably damaging	1.00
R6408:Kif26b	UTSW	1	178917568	missense	probably damaging	1.00
R6488:Kif26b	UTSW	1	178529573	missense	unknown
R6546:Kif26b	UTSW	1	178928306	missense	probably damaging	1.00
R6702:Kif26b	UTSW	1	178917287	missense	possibly damaging	0.90
R6886:Kif26b	UTSW	1	178874138	missense	probably damaging	1.00
R6953:Kif26b	UTSW	1	178874072	missense	possibly damaging	0.89
R7262:Kif26b	UTSW	1	178917654	missense	possibly damaging	0.84
R7291:Kif26b	UTSW	1	178679046	missense	possibly damaging	0.86
R7346:Kif26b	UTSW	1	178530741	missense	probably damaging	1.00
R7383:Kif26b	UTSW	1	178530710	missense	probably damaging	1.00
R7448:Kif26b	UTSW	1	178914774	missense	probably damaging	1.00
R7506:Kif26b	UTSW	1	178529499	start gained	probably benign
R7562:Kif26b	UTSW	1	178914976	missense	probably damaging	1.00
R7583:Kif26b	UTSW	1	178530445	nonsense	probably null
R7585:Kif26b	UTSW	1	178916496	missense	probably benign	0.01
R7644:Kif26b	UTSW	1	178679274	missense	probably benign	0.04
R7759:Kif26b	UTSW	1	178678944	missense	probably damaging	1.00
R7775:Kif26b	UTSW	1	178864876	missense	probably benign	0.15
R7954:Kif26b	UTSW	1	178869379	missense	probably damaging	0.99
R7960:Kif26b	UTSW	1	178678919	missense	probably damaging	1.00
R8012:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
R8152:Kif26b	UTSW	1	178679229	missense	possibly damaging	0.46
R8360:Kif26b	UTSW	1	178916373	missense	probably benign	0.18
R8428:Kif26b	UTSW	1	178917358	missense	probably benign	0.09
R8670:Kif26b	UTSW	1	178913784	missense	probably damaging	1.00
R8737:Kif26b	UTSW	1	178864865	missense	probably damaging	0.99
R8788:Kif26b	UTSW	1	178529525	start gained	probably benign
R8854:Kif26b	UTSW	1	178916383	missense	possibly damaging	0.93
R8870:Kif26b	UTSW	1	178865029	missense	probably damaging	1.00
R8963:Kif26b	UTSW	1	178916149	missense	probably benign	0.00
R9232:Kif26b	UTSW	1	178914946	missense	probably damaging	1.00
R9297:Kif26b	UTSW	1	178715809	nonsense	probably null
R9338:Kif26b	UTSW	1	178916493	missense	probably damaging	1.00
R9572:Kif26b	UTSW	1	178917477	missense	probably benign
R9580:Kif26b	UTSW	1	178679078	nonsense	probably null
R9694:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
X0021:Kif26b	UTSW	1	178928159	missense	probably damaging	1.00
X0024:Kif26b	UTSW	1	178679082	missense	probably benign	0.14
X0025:Kif26b	UTSW	1	178915266	nonsense	probably null
X0025:Kif26b	UTSW	1	178915383	missense	possibly damaging	0.70
Z1177:Kif26b	UTSW	1	178821548	missense	probably benign	0.11
Z1177:Kif26b	UTSW	1	178821550	nonsense	probably null
Z1177:Kif26b	UTSW	1	178915405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGTGTTGCCCAGACCTTACC -3'
(R):5'- TCCGTGACATAGCTTTTGGAAG -3'

Sequencing Primer
(F):5'- GTTGCCCAGACCTTACCCACTC -3'
(R):5'- GTGACATAGCTTTTGGAAGATGATTC -3'

Posted On

2020-07-28