Incidental Mutation 'R7962:Irs1'
ID650144
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82288722 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 591 (R591H)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069799
AA Change: R591H

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: R591H

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R8139:Irs1 UTSW 1 82289739 missense probably damaging 1.00
R8158:Irs1 UTSW 1 82289533 missense probably damaging 1.00
R8159:Irs1 UTSW 1 82288569 missense probably damaging 1.00
R8187:Irs1 UTSW 1 82288300 missense probably damaging 1.00
R8288:Irs1 UTSW 1 82287961 nonsense probably null
R8436:Irs1 UTSW 1 82290249 missense possibly damaging 0.96
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense possibly damaging 0.87
Z1177:Irs1 UTSW 1 82290394 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCATGTAGCCATTGGGGTCC -3'
(R):5'- TCCTACCATTTCCCATCAGAAG -3'

Sequencing Primer
(F):5'- GTAGCCATTGGGGTCCACTCTC -3'
(R):5'- GACCCCCTCACAGTCTTCAGTG -3'
Posted On2020-09-15