Incidental Mutation 'R0311:Med23'
ID25210
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0311 (G1)
Quality Score165
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24897358 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 653 (C653S)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020159
AA Change: C647S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: C647S

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092646
AA Change: C653S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: C653S

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect possibly damaging
Transcript: ENSMUST00000176285
AA Change: C287S

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: C287S

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179967
Meta Mutation Damage Score 0.4973 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 unclassified probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCACTGTCTTCAAGTCCCAC -3'
(R):5'- TCACTACTAGGTAGGCAGCACACAC -3'

Sequencing Primer
(F):5'- TTCAAGTCCCACGCCTGG -3'
(R):5'- taggaggcagaggcacgg -3'
Posted On2013-04-16