Incidental Mutation 'R7925:Mgam'
ID 643269
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R7925 (G1)
Quality Score 999
Status Validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40759051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1574 (T1574I)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: T1574I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: T1574I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: T1574I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: T1574I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202779
AA Change: T947I

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: T947I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202966
AA Change: T828I

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: T828I

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
4933427D14Rik A C 11: 72,180,501 L473V probably benign Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pdgfra T A 5: 75,192,418 probably benign Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Pgls T C 8: 71,592,352 S46P probably damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R8987:Mgam UTSW 6 40729636 missense probably damaging 1.00
R9055:Mgam UTSW 6 40714729 intron probably benign
R9171:Mgam UTSW 6 40768212 missense possibly damaging 0.76
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9262:Mgam UTSW 6 40746488 critical splice donor site probably null
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
R9784:Mgam UTSW 6 40759090 missense probably damaging 1.00
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTCTAGATGGAATATTTCATGG -3'
(R):5'- AAAGACCTTCTATCCAAGATCTGTG -3'

Sequencing Primer
(F):5'- TCTTGAGTCCAGTTGCAG -3'
(R):5'- ACCTTCTATCCAAGATCTGTGGTATG -3'
Posted On 2020-08-07