Mutagenetix > Incidental Mutation

Incidental Mutation 'R1116:Plxnd1'

97265

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

6230425C21Rik, b2b1863Clo, b2b553Clo

MMRRC Submission

039189-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1116 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115931772-115971966 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 115943966 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably null
Transcript: ENSMUST00000015511

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,506,792 (GRCm39)		probably benign	Het
Acacb	C	T	5: 114,349,017 (GRCm39)	P1028S	probably damaging	Het
Acad10	A	G	5: 121,768,814 (GRCm39)	F717S	probably damaging	Het
Adgrg6	A	T	10: 14,314,172 (GRCm39)	Y705N	probably benign	Het
Adm	A	G	7: 110,227,501 (GRCm39)	I6V	probably benign	Het
Agps	T	G	2: 75,692,269 (GRCm39)		probably benign	Het
Atr	C	T	9: 95,749,689 (GRCm39)	Q501*	probably null	Het
Cacna2d3	A	G	14: 28,786,278 (GRCm39)		probably benign	Het
Ccnt1	G	A	15: 98,442,219 (GRCm39)	R350W	probably damaging	Het
Cfap74	G	A	4: 155,518,453 (GRCm39)	E564K	probably benign	Het
Clip1	T	C	5: 123,717,554 (GRCm39)	E1250G	probably damaging	Het
Cryz	A	C	3: 154,327,240 (GRCm39)		probably benign	Het
Dnah1	C	A	14: 31,029,824 (GRCm39)	V494F	probably benign	Het
Dpep3	G	T	8: 106,705,461 (GRCm39)	D96E	probably damaging	Het
Dyrk3	G	A	1: 131,056,919 (GRCm39)	A418V	probably damaging	Het
Ehf	T	A	2: 103,097,354 (GRCm39)	N231I	probably damaging	Het
Eif4g3	T	C	4: 137,819,086 (GRCm39)		probably null	Het
Ergic3	G	A	2: 155,858,707 (GRCm39)	V278M	probably benign	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Fam178b	A	T	1: 36,617,669 (GRCm39)	C82*	probably null	Het
Gm1647	C	T	3: 69,064,205 (GRCm39)	Q31*	probably null	Het
Got1	T	A	19: 43,491,413 (GRCm39)	K346*	probably null	Het
Grid2ip	G	A	5: 143,368,669 (GRCm39)	G656D	possibly damaging	Het
Grm2	A	G	9: 106,525,126 (GRCm39)	Y530H	probably damaging	Het
Hyou1	T	C	9: 44,295,978 (GRCm39)	I381T	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Marchf11	T	C	15: 26,409,381 (GRCm39)	L360P	probably damaging	Het
Mettl17	T	C	14: 52,127,055 (GRCm39)	V281A	probably benign	Het
Micu2	A	T	14: 58,191,657 (GRCm39)	D131E	probably benign	Het
Mug1	G	C	6: 121,847,604 (GRCm39)	V661L	probably benign	Het
Myo18b	A	T	5: 112,951,145 (GRCm39)	D1488E	probably damaging	Het
Nkg7	G	A	7: 43,086,878 (GRCm39)	V51I	probably benign	Het
Nlgn1	A	C	3: 25,488,038 (GRCm39)	S766A	probably benign	Het
Or4d2b	T	A	11: 87,780,234 (GRCm39)	M163L	probably benign	Het
Otog	T	C	7: 45,950,025 (GRCm39)		probably benign	Het
Pax2	T	C	19: 44,745,863 (GRCm39)	S11P	probably damaging	Het
Pck2	A	G	14: 55,782,823 (GRCm39)	D392G	probably benign	Het
Prkdc	A	G	16: 15,600,943 (GRCm39)	D2868G	probably benign	Het
Prl3d2	T	C	13: 27,309,985 (GRCm39)	L149P	probably damaging	Het
Purg	A	T	8: 33,876,773 (GRCm39)	H137L	probably benign	Het
Slc38a8	A	T	8: 120,222,872 (GRCm39)	L150Q	probably damaging	Het
Tifab	T	A	13: 56,324,025 (GRCm39)	R139S	possibly damaging	Het
Txndc16	T	C	14: 45,400,442 (GRCm39)	H353R	probably benign	Het
Ulbp3	A	T	10: 3,070,180 (GRCm39)		noncoding transcript	Het
Upk2	A	G	9: 44,365,086 (GRCm39)		probably null	Het
Zdhhc25	G	A	15: 88,484,823 (GRCm39)	V53I	probably benign	Het
Zfp738	T	A	13: 67,818,362 (GRCm39)		probably null	Het
Zfp810	C	T	9: 22,190,381 (GRCm39)	E176K	probably benign	Het
Zfp846	T	A	9: 20,504,559 (GRCm39)	W140R	possibly damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115,944,933 (GRCm39)	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115,946,906 (GRCm39)	missense	probably benign
IGL01323:Plxnd1	APN	6	115,943,760 (GRCm39)	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115,937,488 (GRCm39)	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115,936,896 (GRCm39)	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115,955,218 (GRCm39)	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115,970,589 (GRCm39)	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115,940,874 (GRCm39)	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115,932,703 (GRCm39)	makesense	probably null
IGL02873:Plxnd1	APN	6	115,936,937 (GRCm39)	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115,939,318 (GRCm39)	missense	probably damaging	1.00
Hiss	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
murmer	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
mutter	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
rattle	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115,946,421 (GRCm39)	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115,935,660 (GRCm39)	splice site	probably benign
R0648:Plxnd1	UTSW	6	115,970,962 (GRCm39)	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115,943,599 (GRCm39)	missense	possibly damaging	0.68
R1292:Plxnd1	UTSW	6	115,939,644 (GRCm39)	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115,945,642 (GRCm39)	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115,944,740 (GRCm39)	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115,971,018 (GRCm39)	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115,957,562 (GRCm39)	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115,943,507 (GRCm39)	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115,940,875 (GRCm39)	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1865:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1875:Plxnd1	UTSW	6	115,955,045 (GRCm39)	splice site	probably null
R1899:Plxnd1	UTSW	6	115,946,324 (GRCm39)	missense	probably benign
R1913:Plxnd1	UTSW	6	115,954,978 (GRCm39)	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115,939,478 (GRCm39)	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115,944,216 (GRCm39)	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115,934,509 (GRCm39)	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115,939,725 (GRCm39)	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115,941,105 (GRCm39)	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115,939,704 (GRCm39)	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115,944,709 (GRCm39)	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115,936,276 (GRCm39)	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115,942,914 (GRCm39)	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115,933,056 (GRCm39)	splice site	probably null
R4280:Plxnd1	UTSW	6	115,933,055 (GRCm39)	splice site	probably benign
R4346:Plxnd1	UTSW	6	115,954,941 (GRCm39)	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115,970,937 (GRCm39)	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115,932,717 (GRCm39)	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115,971,237 (GRCm39)	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115,949,486 (GRCm39)	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115,935,576 (GRCm39)	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115,935,581 (GRCm39)	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115,937,816 (GRCm39)	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115,932,726 (GRCm39)	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115,971,337 (GRCm39)	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115,942,862 (GRCm39)	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115,935,949 (GRCm39)	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115,934,609 (GRCm39)	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115,942,838 (GRCm39)	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115,945,649 (GRCm39)	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115,944,748 (GRCm39)	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115,955,135 (GRCm39)	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115,954,921 (GRCm39)	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115,955,453 (GRCm39)	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115,953,697 (GRCm39)	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115,970,724 (GRCm39)	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115,949,468 (GRCm39)	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115,937,798 (GRCm39)	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115,953,600 (GRCm39)	missense	probably benign
R7699:Plxnd1	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115,943,879 (GRCm39)	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115,933,578 (GRCm39)	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115,949,433 (GRCm39)	missense	probably benign
R8507:Plxnd1	UTSW	6	115,943,866 (GRCm39)	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115,939,768 (GRCm39)	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115,934,558 (GRCm39)	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115,949,506 (GRCm39)	nonsense	probably null
R9119:Plxnd1	UTSW	6	115,932,832 (GRCm39)	splice site	probably benign
R9177:Plxnd1	UTSW	6	115,943,469 (GRCm39)	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115,970,746 (GRCm39)	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115,934,526 (GRCm39)	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115,934,524 (GRCm39)	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115,932,730 (GRCm39)	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115,940,277 (GRCm39)	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115,940,271 (GRCm39)	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115,943,745 (GRCm39)	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115,944,471 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGATGATTTGGATGTCGCAGGACAC -3'
(R):5'- ACGCTTCCACATGGTGCAGAATG -3'

Sequencing Primer
(F):5'- GTGGTACTCATGGCTCTCCAG -3'
(R):5'- ATGGCTGTACACCACATTGG -3'

Posted On

2014-01-05