Mutagenetix > Incidental Mutation

Incidental Mutation 'R1458:Itpr3'

161926

Institutional Source

Beutler Lab

Gene Symbol

Itpr3

Ensembl Gene

ENSMUSG00000042644

Gene Name

inositol 1,4,5-triphosphate receptor 3

Synonyms

tf, Ip3r3, Itpr-3

MMRRC Submission

039513-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1458 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

27057304-27122223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27118372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 2413 (M2413K)

Ref Sequence

ENSEMBL: ENSMUSP00000038150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]

AlphaFold

P70227

PDB Structure

Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025045

Predicted Effect

probably benign
Transcript: ENSMUST00000049308
AA Change: M2413K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: M2413K

Domain	Start	End	E-Value	Type
MIR	113	167	7.75e-6	SMART
MIR	174	224	1.16e-4	SMART
MIR	232	288	1.21e-7	SMART
MIR	295	402	9.38e-14	SMART
Pfam:RYDR_ITPR	473	670	7.8e-64	PFAM
low complexity region	881	889	N/A	INTRINSIC
Pfam:RYDR_ITPR	1175	1333	5.8e-16	PFAM
low complexity region	1549	1567	N/A	INTRINSIC
low complexity region	1831	1851	N/A	INTRINSIC
Pfam:RIH_assoc	1863	1973	2.6e-34	PFAM
transmembrane domain	2203	2225	N/A	INTRINSIC
Pfam:Ion_trans	2235	2527	8.1e-20	PFAM
coiled coil region	2631	2660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118613

Predicted Effect

probably benign
Transcript: ENSMUST00000119227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145148

Meta Mutation Damage Score

0.0726

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	A	G	9: 60,769,761		noncoding transcript	Het
A430110L20Rik	T	A	1: 181,227,858		noncoding transcript	Het
Abce1	T	C	8: 79,707,235	K63R	possibly damaging	Het
Acp6	A	G	3: 97,173,788		probably benign	Het
Adamts13	T	A	2: 26,988,354	L579Q	probably damaging	Het
Adamtsl3	T	A	7: 82,523,320	M497K	probably damaging	Het
Adgrb2	T	A	4: 130,014,591	M1042K	possibly damaging	Het
Akap12	A	T	10: 4,353,693	S168C	probably damaging	Het
Akap3	A	T	6: 126,865,554	M379L	probably damaging	Het
Aldh6a1	C	T	12: 84,439,663	M135I	probably null	Het
Arhgef12	A	G	9: 42,988,998	S860P	probably damaging	Het
Atp11b	A	C	3: 35,789,558	T185P	probably damaging	Het
Bcas1	T	C	2: 170,387,951	D243G	probably damaging	Het
Cdhr2	T	A	13: 54,717,872	S228T	probably damaging	Het
Cic	T	C	7: 25,279,737		probably benign	Het
Cmya5	T	A	13: 93,065,327	I3376L	probably benign	Het
Ctrc	C	A	4: 141,846,224		probably null	Het
D230025D16Rik	T	C	8: 105,246,556		probably null	Het
Dchs1	G	T	7: 105,755,244	P2697Q	probably damaging	Het
Dmbt1	A	G	7: 131,044,487		probably benign	Het
Drd2	G	A	9: 49,402,212	R227H	probably damaging	Het
Dscc1	C	A	15: 55,086,764	C195F	probably damaging	Het
Dzip1	T	A	14: 118,922,713	M28L	probably benign	Het
Edar	A	T	10: 58,607,366	S313T	probably benign	Het
Eef1e1	C	A	13: 38,656,123	A69S	probably damaging	Het
Fbn1	A	G	2: 125,301,929	V2760A	probably benign	Het
Fez1	GACAAACA	GACA	9: 36,870,549		probably null	Het
Fgl1	C	G	8: 41,210,459	A11P	possibly damaging	Het
Fras1	T	C	5: 96,600,733	V689A	probably benign	Het
Fry	T	A	5: 150,380,859	D571E	probably damaging	Het
Gm11232	T	A	4: 71,757,213	R104*	probably null	Het
Gm1527	A	G	3: 28,918,050	I439V	possibly damaging	Het
Gm4922	C	A	10: 18,783,892	G361*	probably null	Het
Gm7052	T	A	17: 22,040,466		probably benign	Het
Gm7534	T	C	4: 134,196,833	D467G	probably benign	Het
Gpatch8	A	T	11: 102,481,229	S494R	unknown	Het
Gria2	A	T	3: 80,732,045	V220E	possibly damaging	Het
Grik4	G	A	9: 42,521,122	H860Y	probably benign	Het
Gtpbp1	A	C	15: 79,707,729	S93R	probably damaging	Het
Gucy2g	C	A	19: 55,215,036		probably benign	Het
Hist1h2ae	C	A	13: 23,571,047		probably benign	Het
Hmcn1	G	A	1: 150,609,700	R4384C	probably damaging	Het
Hspa12b	G	C	2: 131,145,192	A678P	probably damaging	Het
Igsf21	T	A	4: 140,028,124	N407Y	probably damaging	Het
Insig2	A	G	1: 121,307,156	Y174H	probably benign	Het
Kalrn	A	T	16: 34,174,487	I1322N	probably damaging	Het
Klk1b24	T	A	7: 44,191,466	M106K	possibly damaging	Het
Krt81	G	T	15: 101,460,317	Q352K	probably benign	Het
Lca5l	A	T	16: 96,159,859	S468T	possibly damaging	Het
Lvrn	T	C	18: 46,882,385		probably benign	Het
Mcpt1	T	A	14: 56,019,164		probably benign	Het
Med13l	T	C	5: 118,738,459	M900T	probably benign	Het
Med16	A	G	10: 79,907,478		probably benign	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mep1a	T	C	17: 43,491,672	H154R	probably damaging	Het
Mrc2	A	T	11: 105,337,772	D659V	probably benign	Het
Mroh8	T	A	2: 157,221,304	E799V	probably damaging	Het
Mrpl21	A	G	19: 3,284,808	Y50C	possibly damaging	Het
Msl1	A	G	11: 98,803,982		probably benign	Het
Myo1a	C	A	10: 127,719,937	Q932K	probably benign	Het
Nav3	A	C	10: 109,720,044	S1675R	probably damaging	Het
Neurl2	A	G	2: 164,832,746	V232A	possibly damaging	Het
Nfatc1	T	A	18: 80,665,267		probably benign	Het
Odf3l2	A	T	10: 79,645,558		probably benign	Het
Olfr1362	C	T	13: 21,611,822	C49Y	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,676	E11V	probably null	Het
P4hb	A	G	11: 120,562,555		probably benign	Het
Papss1	T	G	3: 131,605,854	I281S	probably damaging	Het
Pde10a	A	T	17: 8,964,708	D832V	probably damaging	Het
Pfkfb2	A	T	1: 130,708,190	Y35N	possibly damaging	Het
Phf20l1	T	A	15: 66,604,813	F253Y	probably damaging	Het
Pkhd1l1	G	A	15: 44,516,115	V1046I	probably benign	Het
Plin3	C	T	17: 56,284,337	A148T	probably benign	Het
Ppp1r8	T	C	4: 132,840,631		probably benign	Het
Ppp2r3a	A	G	9: 101,211,312	L604P	probably damaging	Het
Prdm5	T	C	6: 65,883,601	V239A	probably damaging	Het
Prickle1	A	G	15: 93,500,638	S770P	probably damaging	Het
Prl2c5	T	A	13: 13,190,725	I155N	probably benign	Het
Prom1	T	C	5: 44,032,932		probably benign	Het
Psg25	C	T	7: 18,529,587	G104R	probably damaging	Het
Rbm19	T	C	5: 120,144,029	V817A	probably benign	Het
Ryr2	T	A	13: 11,727,022	Y2091F	probably damaging	Het
Slc16a4	A	G	3: 107,300,932	T253A	probably benign	Het
Smg7	A	T	1: 152,855,843		probably null	Het
Spink5	C	A	18: 44,007,719	H662N	probably benign	Het
Taf2	A	T	15: 55,059,915	M322K	probably damaging	Het
Tmc2	T	C	2: 130,248,762	F676S	probably damaging	Het
Tmem177	A	G	1: 119,910,185	S255P	possibly damaging	Het
Trim46	A	T	3: 89,235,068		probably null	Het
Tubb1	T	A	2: 174,450,803		probably null	Het
Upf1	T	C	8: 70,344,254	T110A	probably benign	Het
Vmn2r9	T	A	5: 108,848,984	I140L	probably benign	Het
Zfp638	T	A	6: 83,944,656	H588Q	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Itpr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Itpr3	APN	17	27083629	missense	probably benign	0.05
IGL00980:Itpr3	APN	17	27110956	missense	probably benign
IGL01151:Itpr3	APN	17	27091529	missense	probably damaging	1.00
IGL01289:Itpr3	APN	17	27099765	missense	probably damaging	0.99
IGL01403:Itpr3	APN	17	27118595	missense	probably damaging	0.97
IGL01666:Itpr3	APN	17	27117178	missense	probably benign	0.02
IGL01897:Itpr3	APN	17	27111262	missense	probably damaging	1.00
IGL02003:Itpr3	APN	17	27121475	missense	probably damaging	1.00
IGL02012:Itpr3	APN	17	27104095	missense	probably benign
IGL02063:Itpr3	APN	17	27120023	missense	probably benign	0.01
IGL02146:Itpr3	APN	17	27117275	missense	probably damaging	1.00
IGL02158:Itpr3	APN	17	27098442	missense	probably damaging	1.00
IGL02177:Itpr3	APN	17	27099614	missense	possibly damaging	0.74
IGL02247:Itpr3	APN	17	27098179	missense	probably damaging	1.00
IGL02606:Itpr3	APN	17	27114512	splice site	probably benign
IGL02651:Itpr3	APN	17	27106398	missense	probably damaging	0.99
IGL02902:Itpr3	APN	17	27104556	missense	probably benign	0.21
IGL03001:Itpr3	APN	17	27089612	splice site	probably benign
IGL03004:Itpr3	APN	17	27097978	missense	possibly damaging	0.90
IGL03065:Itpr3	APN	17	27091933	missense	probably damaging	1.00
IGL03117:Itpr3	APN	17	27119266	missense	probably damaging	1.00
IGL03181:Itpr3	APN	17	27111268	missense	probably benign
IGL03404:Itpr3	APN	17	27091518	missense	probably damaging	1.00
Allure	UTSW	17	27107303	missense	probably damaging	1.00
alopecia	UTSW	17	27095478	missense	probably damaging	0.98
Beauty	UTSW	17	27106342	missense	probably damaging	1.00
Opuesto	UTSW	17	27087592	missense	probably damaging	1.00
Paradox	UTSW	17	27098171	missense	probably damaging	1.00
Pulchritude	UTSW	17	27086960	missense	probably damaging	0.97
R0010:Itpr3	UTSW	17	27120977	missense	probably damaging	1.00
R0055:Itpr3	UTSW	17	27098322	missense	probably damaging	1.00
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0104:Itpr3	UTSW	17	27095992	missense	probably benign	0.01
R0195:Itpr3	UTSW	17	27114114	missense	probably damaging	1.00
R0212:Itpr3	UTSW	17	27089319	missense	probably damaging	1.00
R0454:Itpr3	UTSW	17	27113819	missense	probably benign
R0485:Itpr3	UTSW	17	27111929	missense	probably damaging	0.98
R0501:Itpr3	UTSW	17	27107289	missense	probably benign	0.09
R0781:Itpr3	UTSW	17	27110555	missense	probably benign	0.00
R0890:Itpr3	UTSW	17	27089011	nonsense	probably null
R1028:Itpr3	UTSW	17	27091369	missense	probably benign	0.04
R1144:Itpr3	UTSW	17	27114923	missense	probably benign	0.01
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1463:Itpr3	UTSW	17	27117154	splice site	probably benign
R1472:Itpr3	UTSW	17	27114225	missense	probably benign	0.09
R1529:Itpr3	UTSW	17	27105485	splice site	probably null
R1533:Itpr3	UTSW	17	27095560	missense	possibly damaging	0.71
R1537:Itpr3	UTSW	17	27114147	missense	possibly damaging	0.96
R1618:Itpr3	UTSW	17	27116607	critical splice acceptor site	probably null
R1672:Itpr3	UTSW	17	27089013	missense	probably benign
R1726:Itpr3	UTSW	17	27111690	missense	probably damaging	0.96
R1865:Itpr3	UTSW	17	27120023	missense	probably benign	0.01
R1940:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R2023:Itpr3	UTSW	17	27102811	missense	possibly damaging	0.76
R2063:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2064:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2065:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2067:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2068:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2219:Itpr3	UTSW	17	27115053	missense	probably benign
R2248:Itpr3	UTSW	17	27115059	missense	probably damaging	1.00
R2291:Itpr3	UTSW	17	27113579	missense	possibly damaging	0.92
R2320:Itpr3	UTSW	17	27095915	missense	probably benign
R2864:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R2865:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R3778:Itpr3	UTSW	17	27095472	missense	possibly damaging	0.57
R3881:Itpr3	UTSW	17	27113840	missense	probably benign	0.01
R3979:Itpr3	UTSW	17	27085131	missense	probably benign	0.23
R3979:Itpr3	UTSW	17	27091572	missense	probably damaging	1.00
R4224:Itpr3	UTSW	17	27107258	missense	probably damaging	1.00
R4259:Itpr3	UTSW	17	27106324	missense	probably damaging	1.00
R4321:Itpr3	UTSW	17	27111974	missense	probably benign	0.00
R4466:Itpr3	UTSW	17	27106342	missense	probably damaging	1.00
R4493:Itpr3	UTSW	17	27104612	missense	probably damaging	1.00
R4597:Itpr3	UTSW	17	27093283	missense	probably damaging	1.00
R4823:Itpr3	UTSW	17	27085147	missense	probably benign	0.30
R4921:Itpr3	UTSW	17	27098005	missense	probably damaging	1.00
R4974:Itpr3	UTSW	17	27083608	missense	probably damaging	0.96
R5063:Itpr3	UTSW	17	27089911	missense	possibly damaging	0.94
R5079:Itpr3	UTSW	17	27098423	missense	probably damaging	1.00
R5303:Itpr3	UTSW	17	27116689	missense	probably benign	0.38
R5518:Itpr3	UTSW	17	27087592	missense	probably damaging	1.00
R5521:Itpr3	UTSW	17	27107334	missense	probably benign	0.09
R5566:Itpr3	UTSW	17	27115952	missense	possibly damaging	0.71
R5567:Itpr3	UTSW	17	27103906	missense	possibly damaging	0.66
R5579:Itpr3	UTSW	17	27113519	missense	probably damaging	1.00
R5610:Itpr3	UTSW	17	27118566	missense	probably benign	0.42
R5658:Itpr3	UTSW	17	27107878	missense	possibly damaging	0.74
R5856:Itpr3	UTSW	17	27106405	missense	probably damaging	1.00
R5872:Itpr3	UTSW	17	27086976	missense	probably benign	0.02
R5878:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R5889:Itpr3	UTSW	17	27115065	missense	probably damaging	0.99
R5907:Itpr3	UTSW	17	27117893	missense	probably damaging	1.00
R5930:Itpr3	UTSW	17	27110921	missense	possibly damaging	0.49
R5987:Itpr3	UTSW	17	27104601	missense	probably damaging	1.00
R6029:Itpr3	UTSW	17	27098171	missense	probably damaging	1.00
R6195:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6213:Itpr3	UTSW	17	27111200	missense	probably benign	0.03
R6233:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6376:Itpr3	UTSW	17	27095475	missense	possibly damaging	0.94
R6514:Itpr3	UTSW	17	27091370	missense	probably benign
R6515:Itpr3	UTSW	17	27091370	missense	probably benign
R6516:Itpr3	UTSW	17	27091370	missense	probably benign
R6955:Itpr3	UTSW	17	27121467	missense	probably damaging	1.00
R7002:Itpr3	UTSW	17	27110580	missense	probably benign	0.00
R7064:Itpr3	UTSW	17	27089295	missense	probably damaging	1.00
R7257:Itpr3	UTSW	17	27118561	missense	probably benign	0.00
R7349:Itpr3	UTSW	17	27107812	splice site	probably null
R7469:Itpr3	UTSW	17	27121054	missense	possibly damaging	0.74
R7493:Itpr3	UTSW	17	27094800	missense	probably benign	0.09
R7510:Itpr3	UTSW	17	27089039	missense	probably damaging	0.97
R7565:Itpr3	UTSW	17	27110888	missense	probably benign	0.01
R7616:Itpr3	UTSW	17	27088977	missense	probably damaging	1.00
R7728:Itpr3	UTSW	17	27098114	missense	probably damaging	1.00
R7779:Itpr3	UTSW	17	27096063	missense	probably damaging	1.00
R7788:Itpr3	UTSW	17	27118597	nonsense	probably null
R7871:Itpr3	UTSW	17	27117179	missense	probably damaging	1.00
R7889:Itpr3	UTSW	17	27116777	missense	probably damaging	1.00
R7966:Itpr3	UTSW	17	27112028	critical splice donor site	probably null
R8065:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8067:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8230:Itpr3	UTSW	17	27107737	critical splice donor site	probably null
R8263:Itpr3	UTSW	17	27115913	nonsense	probably null
R8264:Itpr3	UTSW	17	27104112	synonymous	silent
R8269:Itpr3	UTSW	17	27093284	missense	possibly damaging	0.60
R8271:Itpr3	UTSW	17	27087648	missense	probably damaging	1.00
R8316:Itpr3	UTSW	17	27106225	missense	possibly damaging	0.50
R8354:Itpr3	UTSW	17	27115919	missense	possibly damaging	0.74
R8413:Itpr3	UTSW	17	27111926	missense	probably damaging	1.00
R8437:Itpr3	UTSW	17	27107303	missense	probably damaging	1.00
R8676:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8679:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8846:Itpr3	UTSW	17	27112022	missense	probably damaging	1.00
R8884:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8885:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8886:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8887:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8888:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8891:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8896:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8975:Itpr3	UTSW	17	27116654	missense	possibly damaging	0.56
R9025:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9026:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9063:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9087:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9088:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9089:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9090:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9091:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9200:Itpr3	UTSW	17	27107662	missense	probably damaging	0.99
R9270:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9271:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9294:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R9389:Itpr3	UTSW	17	27095925	missense	possibly damaging	0.84
R9433:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9434:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9443:Itpr3	UTSW	17	27105549	missense	probably damaging	1.00
R9472:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9474:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9475:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9476:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9477:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9507:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9508:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9511:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9694:Itpr3	UTSW	17	27115953	missense	probably damaging	0.99
R9789:Itpr3	UTSW	17	27089941	missense	probably benign	0.15
V7732:Itpr3	UTSW	17	27111024	splice site	probably benign
V7732:Itpr3	UTSW	17	27111026	splice site	probably null
Z1088:Itpr3	UTSW	17	27113528	missense	possibly damaging	0.50
Z1177:Itpr3	UTSW	17	27114929	missense	probably damaging	1.00
Z1177:Itpr3	UTSW	17	27119987	missense	probably damaging	1.00
Z31818:Itpr3	UTSW	17	27095478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCATCTGTCATTCGTGCAGAGC -3'
(R):5'- ACATAAGTAGAGTGTCACAGGCCCG -3'

Sequencing Primer
(F):5'- CATTCGTGCAGAGCTTGGTG -3'
(R):5'- CGTGCTATCGGGCTCCTC -3'

Posted On

2014-03-14