Incidental Mutation 'R3798:Wdr90'
ID272856
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3798 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25850498 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1194 (S1194G)
Ref Sequence ENSEMBL: ENSMUSP00000135420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079461] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000079461
AA Change: S1212G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: S1212G

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect probably benign
Transcript: ENSMUST00000176923
AA Change: S1194G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: S1194G

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R7953:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7992:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R8126:Wdr90 UTSW 17 25848977 missense possibly damaging 0.48
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACTATCAGATGGAGGCTGTG -3'
(R):5'- AGAGACCAAGACCTCTGTCAG -3'

Sequencing Primer
(F):5'- CTATCAGATGGAGGCTGTGTGTGAG -3'
(R):5'- TCCTGAAAGATGACTTGAGGTC -3'
Posted On2015-03-25