Incidental Mutation 'R7288:Wdr90'
ID566194
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25846312 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1657 (S1657P)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079461
AA Change: S1657P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: S1657P

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably benign
Transcript: ENSMUST00000176923
AA Change: S1639P

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: S1639P

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R7953:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7992:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R8126:Wdr90 UTSW 17 25848977 missense possibly damaging 0.48
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGACTATGATGCCATTATGTGAG -3'
(R):5'- TGATCCAGTTTCAGGTGCTG -3'

Sequencing Primer
(F):5'- TGATGCCATTATGTGAGCCCAAC -3'
(R):5'- ACACTAGAGCTGTCTCTG -3'
Posted On2019-06-26