Incidental Mutation 'R3765:Pla2g12b'
ID274665
Institutional Source Beutler Lab
Gene Symbol Pla2g12b
Ensembl Gene ENSMUSG00000009646
Gene Namephospholipase A2, group XIIB
Synonyms2010002E04Rik, hlb218, Pla2g13
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location59403660-59421976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59421501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 169 (V169M)
Ref Sequence ENSEMBL: ENSMUSP00000009790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009790] [ENSMUST00000009798] [ENSMUST00000162643]
Predicted Effect probably damaging
Transcript: ENSMUST00000009790
AA Change: V169M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009790
Gene: ENSMUSG00000009646
AA Change: V169M

DomainStartEndE-ValueType
Pfam:PLA2G12 12 195 1.5e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009798
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162643
SMART Domains Protein: ENSMUSP00000123842
Gene: ENSMUSG00000009646

DomainStartEndE-ValueType
Pfam:PLA2G12 1 77 1.7e-36 PFAM
low complexity region 90 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit a reduction in serum total and HDL cholesterol levels, decreased serum triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Pla2g12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Pla2g12b APN 10 59416417 missense probably benign 0.28
IGL02526:Pla2g12b APN 10 59416453 missense probably damaging 1.00
IGL02551:Pla2g12b APN 10 59403870 missense probably damaging 1.00
florissant UTSW 10 59421441 unclassified probably benign
R0800:Pla2g12b UTSW 10 59403820 missense probably benign 0.00
R0918:Pla2g12b UTSW 10 59421484 missense probably damaging 0.98
R1412:Pla2g12b UTSW 10 59403982 critical splice donor site probably null
R1602:Pla2g12b UTSW 10 59421553 splice site probably null
R4822:Pla2g12b UTSW 10 59416514 critical splice donor site probably null
R5963:Pla2g12b UTSW 10 59403958 missense probably damaging 1.00
R6140:Pla2g12b UTSW 10 59421441 unclassified probably benign
R7889:Pla2g12b UTSW 10 59421240 splice site probably null
R7897:Pla2g12b UTSW 10 59410994 nonsense probably null
R8075:Pla2g12b UTSW 10 59421452 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTCACTTGAAGGTATGCTG -3'
(R):5'- TCAAAGGACAAGGCCTGCTG -3'

Sequencing Primer
(F):5'- TGAAGGTATGCTGTTCTTTTAACTC -3'
(R):5'- CCAGCTCGTGATTTCCGAAG -3'
Posted On2015-04-02