Mutagenetix > Incidental Mutation

Incidental Mutation 'R4655:Gldc'

352400

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

041915-MU

Accession Numbers

Genbank: NM_138595.1

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4655 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 30160702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

AlphaFold

Q91W43

Predicted Effect

probably benign
Transcript: ENSMUST00000025778

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000080982

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,472,858	V300A	probably benign	Het
Abca4	A	G	3: 122,147,498	N405S	possibly damaging	Het
Acsl3	A	G	1: 78,690,346	T212A	probably damaging	Het
Ahnak	A	G	19: 9,008,701	K2450E	probably damaging	Het
Akap9	G	A	5: 4,046,403	R2426H	probably benign	Het
Akr1c6	T	C	13: 4,449,429	V266A	probably damaging	Het
Ccs	A	G	19: 4,839,204	V11A	probably benign	Het
Cdc14a	T	A	3: 116,328,487	H228L	probably damaging	Het
Cgn	G	A	3: 94,779,249	Q248*	probably null	Het
Cux2	G	A	5: 121,885,934	T92M	possibly damaging	Het
Cyb5r4	A	G	9: 87,059,429	K68E	probably benign	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dnah9	T	C	11: 65,955,732	N2918S	probably benign	Het
Dyrk1b	T	C	7: 28,185,751	V438A	probably damaging	Het
Eml1	G	A	12: 108,534,713	D625N	probably damaging	Het
Eno2	T	C	6: 124,763,926		probably null	Het
Ephb3	G	A	16: 21,222,208	G672D	probably damaging	Het
Evx1	A	T	6: 52,314,197	D118V	probably damaging	Het
Fbxl13	A	G	5: 21,582,039	L300S	probably damaging	Het
Fbxo30	T	C	10: 11,291,093	F520L	probably damaging	Het
Flt3	G	A	5: 147,349,593	P728S	possibly damaging	Het
Gas2l2	T	C	11: 83,423,175	E437G	possibly damaging	Het
Gm10334	T	A	6: 41,446,050	I6F	probably benign	Het
Gm13124	A	T	4: 144,555,075	F382L	probably benign	Het
Gm18856	T	C	13: 13,965,647		probably benign	Het
Gm7358	A	T	17: 14,059,148		noncoding transcript	Het
Grifin	A	G	5: 140,564,545	V47A	possibly damaging	Het
Hddc2	G	T	10: 31,328,020		probably benign	Het
Hist1h3f	T	C	13: 23,544,753	V90A	probably benign	Het
Hkdc1	T	A	10: 62,400,463	R433S	probably benign	Het
Htt	A	G	5: 34,906,132	D2918G	probably benign	Het
Itga2	A	C	13: 114,873,269	D383E	probably benign	Het
Itpr1	G	A	6: 108,481,293	C2007Y	probably damaging	Het
Krt42	C	A	11: 100,269,845	Q9H	probably damaging	Het
Lyrm7	T	C	11: 54,848,608	Q72R	probably damaging	Het
Mmp9	A	G	2: 164,951,202	S424G	probably benign	Het
Mtr	A	G	13: 12,227,793	V457A	probably damaging	Het
Myo15b	T	C	11: 115,890,697	L1359P	probably damaging	Het
Neb	A	G	2: 52,227,299	L4087P	probably damaging	Het
Npl	T	C	1: 153,515,406	D201G	probably damaging	Het
Olfr1047	A	G	2: 86,228,693	S93P	probably benign	Het
Olfr366	A	G	2: 37,219,873	N128S	probably benign	Het
Olfr905	C	A	9: 38,472,824	P26T	probably damaging	Het
Pclo	T	C	5: 14,682,383		probably benign	Het
Pdp2	A	G	8: 104,594,536	D339G	probably benign	Het
Pfdn6	A	T	17: 33,940,040	Y16*	probably null	Het
Pilra	C	T	5: 137,835,326		probably null	Het
Prrc2a	A	T	17: 35,155,614	N1353K	probably benign	Het
Ptger4	C	A	15: 5,243,064	A50S	probably benign	Het
Pus10	T	C	11: 23,672,707	V109A	probably benign	Het
Pus3	A	C	9: 35,564,932	D39A	probably benign	Het
Rab44	A	G	17: 29,139,194	N119D	probably benign	Het
Rasgrp2	T	C	19: 6,404,846		probably benign	Het
Rhobtb2	T	A	14: 69,795,989	I511F	probably damaging	Het
Sfxn1	C	A	13: 54,092,438	A167D	probably benign	Het
Slc12a6	A	G	2: 112,357,766		probably null	Het
Smyd4	C	T	11: 75,390,732	L344F	probably damaging	Het
Srsf11	A	G	3: 158,023,335	V93A	probably benign	Het
Tle1	A	G	4: 72,145,344	I224T	possibly damaging	Het
Tmc6	A	T	11: 117,773,042	S479R	possibly damaging	Het
Tmprss4	T	C	9: 45,176,404	M296V	probably benign	Het
Togaram1	A	G	12: 64,967,120	N382D	possibly damaging	Het
Tpcn1	A	G	5: 120,539,257	S662P	probably damaging	Het
Tppp	G	T	13: 74,030,864	R141S	probably benign	Het
Ttc21a	A	G	9: 119,961,762	D858G	possibly damaging	Het
Tuba3a	A	G	6: 125,281,167	S287P	possibly damaging	Het
Unc80	T	G	1: 66,671,662	S2697A	probably benign	Het
Vmn1r69	A	G	7: 10,580,099	V235A	probably benign	Het
Vmn2r26	T	A	6: 124,061,416	I650N	probably damaging	Het
Vmn2r53	G	A	7: 12,582,005	T629I	possibly damaging	Het
Vmn2r74	T	C	7: 85,961,347	T46A	probably benign	Het
Vmn2r84	A	T	10: 130,394,104	C46*	probably null	Het
Vps13b	T	C	15: 35,770,689	S2093P	probably benign	Het
Wdfy4	T	C	14: 32,989,936	R2375G	probably damaging	Het
Wnk2	T	G	13: 49,056,883	E1820A	probably damaging	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0269:Gldc	UTSW	19	30118602	missense	probably damaging	0.98
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1500:Gldc	UTSW	19	30113825	missense	possibly damaging	0.88
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1592:Gldc	UTSW	19	30160677	intron	probably benign
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3836:Gldc	UTSW	19	30118675	splice site	probably benign
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4191:Gldc	UTSW	19	30145658	missense	probably damaging	0.96
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8818:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
R9070:Gldc	UTSW	19	30103004	missense	probably damaging	1.00
R9100:Gldc	UTSW	19	30099914	missense	possibly damaging	0.81
R9144:Gldc	UTSW	19	30137193	missense
R9163:Gldc	UTSW	19	30134286	missense	probably benign	0.13
R9429:Gldc	UTSW	19	30113772	missense	possibly damaging	0.88
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- GGACATGGTTAAAAGGAGTACTGTC -3'
(R):5'- TACTCGGCTGCGATATGGAAC -3'

Sequencing Primer
(F):5'- ACTGTCAAGTGAATTGTGTCTCC -3'
(R):5'- GGAACGTTCCTTATTCCCTTGG -3'

Posted On

2015-10-08