Incidental Mutation 'R4655:Gldc'
ID352400
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 041915-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4655 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 30160702 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080982
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,858 V300A probably benign Het
Abca4 A G 3: 122,147,498 N405S possibly damaging Het
Acsl3 A G 1: 78,690,346 T212A probably damaging Het
Ahnak A G 19: 9,008,701 K2450E probably damaging Het
Akap9 G A 5: 4,046,403 R2426H probably benign Het
Akr1c6 T C 13: 4,449,429 V266A probably damaging Het
Ccs A G 19: 4,839,204 V11A probably benign Het
Cdc14a T A 3: 116,328,487 H228L probably damaging Het
Cgn G A 3: 94,779,249 Q248* probably null Het
Cux2 G A 5: 121,885,934 T92M possibly damaging Het
Cyb5r4 A G 9: 87,059,429 K68E probably benign Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dnah9 T C 11: 65,955,732 N2918S probably benign Het
Dyrk1b T C 7: 28,185,751 V438A probably damaging Het
Eml1 G A 12: 108,534,713 D625N probably damaging Het
Eno2 T C 6: 124,763,926 probably null Het
Ephb3 G A 16: 21,222,208 G672D probably damaging Het
Evx1 A T 6: 52,314,197 D118V probably damaging Het
Fbxl13 A G 5: 21,582,039 L300S probably damaging Het
Fbxo30 T C 10: 11,291,093 F520L probably damaging Het
Flt3 G A 5: 147,349,593 P728S possibly damaging Het
Gas2l2 T C 11: 83,423,175 E437G possibly damaging Het
Gm10334 T A 6: 41,446,050 I6F probably benign Het
Gm13124 A T 4: 144,555,075 F382L probably benign Het
Gm18856 T C 13: 13,965,647 probably benign Het
Gm7358 A T 17: 14,059,148 noncoding transcript Het
Grifin A G 5: 140,564,545 V47A possibly damaging Het
Hddc2 G T 10: 31,328,020 probably benign Het
Hist1h3f T C 13: 23,544,753 V90A probably benign Het
Hkdc1 T A 10: 62,400,463 R433S probably benign Het
Htt A G 5: 34,906,132 D2918G probably benign Het
Itga2 A C 13: 114,873,269 D383E probably benign Het
Itpr1 G A 6: 108,481,293 C2007Y probably damaging Het
Krt42 C A 11: 100,269,845 Q9H probably damaging Het
Lyrm7 T C 11: 54,848,608 Q72R probably damaging Het
Mmp9 A G 2: 164,951,202 S424G probably benign Het
Mtr A G 13: 12,227,793 V457A probably damaging Het
Myo15b T C 11: 115,890,697 L1359P probably damaging Het
Neb A G 2: 52,227,299 L4087P probably damaging Het
Npl T C 1: 153,515,406 D201G probably damaging Het
Olfr1047 A G 2: 86,228,693 S93P probably benign Het
Olfr366 A G 2: 37,219,873 N128S probably benign Het
Olfr905 C A 9: 38,472,824 P26T probably damaging Het
Pclo T C 5: 14,682,383 probably benign Het
Pdp2 A G 8: 104,594,536 D339G probably benign Het
Pfdn6 A T 17: 33,940,040 Y16* probably null Het
Pilra C T 5: 137,835,326 probably null Het
Prrc2a A T 17: 35,155,614 N1353K probably benign Het
Ptger4 C A 15: 5,243,064 A50S probably benign Het
Pus10 T C 11: 23,672,707 V109A probably benign Het
Pus3 A C 9: 35,564,932 D39A probably benign Het
Rab44 A G 17: 29,139,194 N119D probably benign Het
Rasgrp2 T C 19: 6,404,846 probably benign Het
Rhobtb2 T A 14: 69,795,989 I511F probably damaging Het
Sfxn1 C A 13: 54,092,438 A167D probably benign Het
Slc12a6 A G 2: 112,357,766 probably null Het
Smyd4 C T 11: 75,390,732 L344F probably damaging Het
Srsf11 A G 3: 158,023,335 V93A probably benign Het
Tle1 A G 4: 72,145,344 I224T possibly damaging Het
Tmc6 A T 11: 117,773,042 S479R possibly damaging Het
Tmprss4 T C 9: 45,176,404 M296V probably benign Het
Togaram1 A G 12: 64,967,120 N382D possibly damaging Het
Tpcn1 A G 5: 120,539,257 S662P probably damaging Het
Tppp G T 13: 74,030,864 R141S probably benign Het
Ttc21a A G 9: 119,961,762 D858G possibly damaging Het
Tuba3a A G 6: 125,281,167 S287P possibly damaging Het
Unc80 T G 1: 66,671,662 S2697A probably benign Het
Vmn1r69 A G 7: 10,580,099 V235A probably benign Het
Vmn2r26 T A 6: 124,061,416 I650N probably damaging Het
Vmn2r53 G A 7: 12,582,005 T629I possibly damaging Het
Vmn2r74 T C 7: 85,961,347 T46A probably benign Het
Vmn2r84 A T 10: 130,394,104 C46* probably null Het
Vps13b T C 15: 35,770,689 S2093P probably benign Het
Wdfy4 T C 14: 32,989,936 R2375G probably damaging Het
Wnk2 T G 13: 49,056,883 E1820A probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGACATGGTTAAAAGGAGTACTGTC -3'
(R):5'- TACTCGGCTGCGATATGGAAC -3'

Sequencing Primer
(F):5'- ACTGTCAAGTGAATTGTGTCTCC -3'
(R):5'- GGAACGTTCCTTATTCCCTTGG -3'
Posted On2015-10-08