Incidental Mutation 'R7332:Gldc'
ID569333
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7332 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30116526 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 697 (L697Q)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: L697Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: L697Q

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.9687 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hps1 T C 19: 42,777,912 probably null Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Slco3a1 G A 7: 74,318,484 A496V possibly damaging Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp729b T C 13: 67,609,636 probably null Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTCCTGACAATATAAGCTGCTTG -3'
(R):5'- AAAAGGGCTTTGCTGCTGC -3'

Sequencing Primer
(F):5'- CCTGACAATATAAGCTGCTTGGTTTC -3'
(R):5'- TGGGGTGATTTATGAAGGACC -3'
Posted On2019-09-13