Incidental Mutation 'R7390:Gldc'
ID573401
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7390 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30099914 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 953 (S953T)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025778
AA Change: S953T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: S953T

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A G 9: 94,537,383 S165P probably damaging Het
4930486L24Rik A T 13: 60,844,338 D291E probably benign Het
Abca9 C T 11: 110,145,661 V541I probably benign Het
Adamts15 A T 9: 30,911,108 probably null Het
Adgrg7 A G 16: 56,732,844 I630T probably damaging Het
Ahnak A G 19: 9,003,205 I618V probably benign Het
Amotl2 T A 9: 102,731,690 V801E probably damaging Het
Ankrd17 T C 5: 90,282,920 T1002A probably benign Het
Bmp7 C T 2: 172,870,205 D409N probably damaging Het
Bpifb2 A G 2: 153,889,806 N293S possibly damaging Het
Ccdc162 A G 10: 41,634,048 C854R probably benign Het
Ccdc171 A G 4: 83,818,067 E1225G probably damaging Het
Cep350 T C 1: 155,866,087 E2146G possibly damaging Het
Ces1a A C 8: 93,044,841 probably null Het
Cfap45 T G 1: 172,541,358 D444E probably benign Het
Cfap61 T C 2: 146,001,882 V296A probably benign Het
Cgnl1 C T 9: 71,645,649 R1011H probably benign Het
Cops4 C T 5: 100,543,875 R347C probably damaging Het
D16Ertd472e G T 16: 78,547,688 D177E probably benign Het
Dcdc2a T C 13: 25,107,617 V195A possibly damaging Het
Dpagt1 G A 9: 44,332,022 V285I probably benign Het
Dspp G T 5: 104,175,686 A232S probably damaging Het
Ephx2 G A 14: 66,110,455 Het
Fat1 T C 8: 44,952,474 V754A possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gm1123 T C 9: 99,010,980 N315S probably benign Het
Gm11639 T C 11: 104,724,585 I726T possibly damaging Het
Golga2 A G 2: 32,288,190 E37G Het
Gpr139 T A 7: 119,144,612 Q250L probably benign Het
Grik3 C T 4: 125,649,739 R283C probably damaging Het
Haao A C 17: 83,846,652 V22G probably damaging Het
Hspg2 T A 4: 137,539,179 F1884I probably damaging Het
Hyal3 G A 9: 107,584,967 G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 I266K probably benign Het
Klhl26 A C 8: 70,452,849 L137R probably damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lars A G 18: 42,210,018 probably null Het
Lats1 C T 10: 7,702,095 Q328* probably null Het
Lingo3 G A 10: 80,834,629 T489I probably damaging Het
Lmtk2 T C 5: 144,129,443 V65A possibly damaging Het
Lysmd1 T C 3: 95,138,484 S211P probably damaging Het
Med15 C T 16: 17,722,762 S21N unknown Het
Nav1 T C 1: 135,584,918 T135A probably benign Het
Nt5c1a G C 4: 123,208,479 R66T probably benign Het
Pclo T C 5: 14,682,010 Y3509H unknown Het
Pkp4 G A 2: 59,310,140 G397R possibly damaging Het
Ppp1r21 G A 17: 88,549,530 A138T probably benign Het
Pum3 A T 19: 27,424,242 V136D probably benign Het
Rab11fip3 A T 17: 26,068,152 D342E possibly damaging Het
Rcvrn T A 11: 67,700,057 W156R probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Serpina1d T C 12: 103,767,778 D89G possibly damaging Het
Sgsm3 T A 15: 81,008,820 V366E possibly damaging Het
Shank3 T G 15: 89,549,312 L1420R probably benign Het
Sirpb1b A T 3: 15,543,040 L215* probably null Het
Slc16a13 C T 11: 70,218,971 V235I probably benign Het
Slc16a14 T C 1: 84,929,466 D29G probably benign Het
Speer1 T C 5: 11,344,912 V122A probably benign Het
Spns2 T A 11: 72,456,878 T329S possibly damaging Het
Sufu G A 19: 46,450,669 probably null Het
Tll2 A G 19: 41,120,169 probably null Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Trim42 A C 9: 97,359,129 N683K probably damaging Het
Trmt5 A G 12: 73,281,620 S270P probably damaging Het
Vmn1r59 C A 7: 5,453,987 R258L possibly damaging Het
Vmn2r32 A G 7: 7,479,852 L41S probably benign Het
Vmn2r93 A T 17: 18,305,067 E329V probably damaging Het
Ywhae G T 11: 75,764,661 E253* probably null Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TTCACGGGCTATCCTAGATACAC -3'
(R):5'- AGGGAGACTCTTCCTCATGG -3'

Sequencing Primer
(F):5'- CTTTATATAATGAGACTGTGGATGGG -3'
(R):5'- CATGGTATGAGCTATGTTGTCAG -3'
Posted On2019-09-13