Incidental Mutation 'R4784:Pikfyve'
ID366782
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Namephosphoinositide kinase, FYVE type zinc finger containing
SynonymsPip5k3
MMRRC Submission 041994-MU
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4784 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location65186683-65278695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65267846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1798 (T1798A)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
Predicted Effect probably benign
Transcript: ENSMUST00000081154
AA Change: T1753A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: T1753A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: T1798A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: T1798A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,637,824 S83T probably damaging Het
Aff1 T A 5: 103,847,039 Y1034* probably null Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Asns T G 6: 7,678,029 K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Chaf1b T C 16: 93,884,542 V16A probably damaging Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dchs1 A G 7: 105,765,926 Y684H probably damaging Het
Dcun1d3 T C 7: 119,857,664 E275G probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dglucy A T 12: 100,838,664 D168V probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnajc17 T C 2: 119,179,428 D239G probably benign Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elavl2 T C 4: 91,254,142 R265G probably null Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Epha8 A T 4: 136,933,322 I695N probably damaging Het
Fam103a1 T A 7: 81,768,415 W73R probably damaging Het
Fam178b C A 1: 36,632,415 probably null Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fscn2 T C 11: 120,367,987 F453L possibly damaging Het
Gabrb2 T C 11: 42,597,642 C312R probably damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
H2-Q7 T G 17: 35,439,938 C122G probably damaging Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hes3 A G 4: 152,287,832 S37P probably damaging Het
Hs3st3b1 T C 11: 63,889,260 H347R probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Kcnc1 G T 7: 46,437,287 S570I probably benign Het
Kctd3 T C 1: 188,974,468 I523M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Krt83 A G 15: 101,487,956 S253P probably damaging Het
Ktn1 T A 14: 47,693,496 probably null Het
Lair1 T A 7: 4,009,732 M251L probably benign Het
Lama3 A T 18: 12,449,544 H631L probably benign Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrit1 C T 14: 37,062,236 T507M possibly damaging Het
Lrp11 A G 10: 7,604,201 H345R possibly damaging Het
Lrp6 A C 6: 134,479,539 S921A probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Marf1 A C 16: 14,152,457 S133A probably benign Het
Mga C T 2: 119,903,057 P129S probably damaging Het
Mgat4e T C 1: 134,541,325 N327S probably damaging Het
Mlh1 A G 9: 111,239,798 Y499H probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Naalad2 T C 9: 18,350,918 R442G probably damaging Het
Nat8f4 T C 6: 85,901,499 H14R probably benign Het
Nav1 A G 1: 135,458,739 S1184P probably damaging Het
Nckap1 T A 2: 80,506,934 N986I probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,746,402 probably benign Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr172 G T 16: 58,760,548 F209L probably damaging Het
Olfr675 A C 7: 105,024,530 I150S probably damaging Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Ppp1r14a A T 7: 29,292,061 E98V possibly damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prpf8 T A 11: 75,492,505 D521E probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc37a3 T G 6: 39,337,223 Q485P probably benign Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Tas2r125 A G 6: 132,909,903 I85V probably benign Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnip1 A C 11: 54,915,539 S570A possibly damaging Het
Top1mt G A 15: 75,657,703 P554S probably damaging Het
Top1mt A G 15: 75,676,031 F69L possibly damaging Het
Ttc7 A G 17: 87,340,897 K508R probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Xpo5 T C 17: 46,222,717 Y500H possibly damaging Het
Xpot C T 10: 121,615,063 probably null Het
Zbbx T C 3: 75,085,041 I268V probably benign Het
Zbtb40 G A 4: 137,007,097 P360S probably damaging Het
Zfp324 T C 7: 12,971,306 L474P probably damaging Het
Zfp398 A G 6: 47,840,252 T9A probably benign Het
Zfp692 A C 11: 58,310,171 S293R probably null Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATTTGTCTGTCTAATGTGTG -3'
(R):5'- GCCAAGCTCTACATCTCTCAATTAC -3'

Sequencing Primer
(F):5'- TGACTTGCTAACTTCTGTTG -3'
(R):5'- AATACCTAACACTCATT -3'
Posted On2015-12-29