Incidental Mutation 'R4784:Pikfyve'
ID 366782
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 041994-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4784 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65307005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1798 (T1798A)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect probably benign
Transcript: ENSMUST00000081154
AA Change: T1753A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: T1753A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: T1798A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: T1798A

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,875,273 (GRCm39) S83T probably damaging Het
Aff1 T A 5: 103,994,905 (GRCm39) Y1034* probably null Het
Ago3 A T 4: 126,262,296 (GRCm39) M418K probably benign Het
Alpk1 G T 3: 127,481,241 (GRCm39) N175K possibly damaging Het
Als2 A G 1: 59,254,472 (GRCm39) V295A probably benign Het
Arhgap32 A G 9: 32,040,949 (GRCm39) D67G probably damaging Het
Arhgap32 T C 9: 32,172,076 (GRCm39) C1619R probably damaging Het
Asns T G 6: 7,678,029 (GRCm39) K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 (GRCm39) D576V probably damaging Het
Atrnl1 A G 19: 57,617,590 (GRCm39) I122V probably damaging Het
Baz1b T G 5: 135,246,267 (GRCm39) L572R possibly damaging Het
C4b T C 17: 34,952,380 (GRCm39) T1220A probably benign Het
Carmil3 T C 14: 55,738,778 (GRCm39) probably null Het
Ccndbp1 A T 2: 120,839,003 (GRCm39) T5S probably benign Het
Chaf1b T C 16: 93,681,430 (GRCm39) V16A probably damaging Het
Chd8 C A 14: 52,442,825 (GRCm39) C575F probably damaging Het
Chrna10 G A 7: 101,762,426 (GRCm39) P255S possibly damaging Het
Clip1 T C 5: 123,717,356 (GRCm39) D1387G probably damaging Het
Col12a1 C A 9: 79,585,776 (GRCm39) V1228F possibly damaging Het
Cxcr5 T C 9: 44,424,638 (GRCm39) T340A probably benign Het
Cyp2e1 G A 7: 140,343,821 (GRCm39) V20I possibly damaging Het
Dchs1 A G 7: 105,415,133 (GRCm39) Y684H probably damaging Het
Dcun1d3 T C 7: 119,456,887 (GRCm39) E275G probably damaging Het
Dgcr8 G A 16: 18,076,174 (GRCm39) R4* probably null Het
Dglucy A T 12: 100,804,923 (GRCm39) D168V probably damaging Het
Dnah1 T A 14: 30,985,436 (GRCm39) K3818N probably damaging Het
Dnajc17 T C 2: 119,009,909 (GRCm39) D239G probably benign Het
Dok2 C T 14: 71,015,314 (GRCm39) P347L probably benign Het
Elavl2 T C 4: 91,142,379 (GRCm39) R265G probably null Het
Elf1 T A 14: 79,818,183 (GRCm39) N567K probably benign Het
Epha8 A T 4: 136,660,633 (GRCm39) I695N probably damaging Het
Fam178b C A 1: 36,671,496 (GRCm39) probably null Het
Fam76a A T 4: 132,629,428 (GRCm39) probably null Het
Fam76a A G 4: 132,643,501 (GRCm39) Y78H probably damaging Het
Fbn1 A T 2: 125,166,839 (GRCm39) C2026S probably damaging Het
Fbxo4 T C 15: 3,998,523 (GRCm39) T312A probably benign Het
Fscn2 T C 11: 120,258,813 (GRCm39) F453L possibly damaging Het
Gabrb2 T C 11: 42,488,469 (GRCm39) C312R probably damaging Het
Gba2 A C 4: 43,568,315 (GRCm39) L684R probably damaging Het
Golga2 T A 2: 32,187,168 (GRCm39) N89K probably damaging Het
Gpx6 C T 13: 21,496,434 (GRCm39) Q3* probably null Het
Grin1 T A 2: 25,182,393 (GRCm39) H956L possibly damaging Het
H2-Q7 T G 17: 35,658,914 (GRCm39) C122G probably damaging Het
Hcar2 C G 5: 124,002,513 (GRCm39) G330A probably benign Het
Hes3 A G 4: 152,372,289 (GRCm39) S37P probably damaging Het
Hs3st3b1 T C 11: 63,780,086 (GRCm39) H347R probably benign Het
Il1rl1 A G 1: 40,489,348 (GRCm39) R367G probably damaging Het
Kcnc1 G T 7: 46,086,711 (GRCm39) S570I probably benign Het
Kctd3 T C 1: 188,706,665 (GRCm39) I523M probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kntc1 T G 5: 123,954,825 (GRCm39) M2081R possibly damaging Het
Krt87 A G 15: 101,385,837 (GRCm39) S253P probably damaging Het
Ktn1 T A 14: 47,930,953 (GRCm39) probably null Het
Lair1 T A 7: 4,012,731 (GRCm39) M251L probably benign Het
Lama3 A T 18: 12,582,601 (GRCm39) H631L probably benign Het
Lamc1 T C 1: 153,107,486 (GRCm39) N1231S probably damaging Het
Lin54 A G 5: 100,607,597 (GRCm39) I250T probably damaging Het
Lrit1 C T 14: 36,784,193 (GRCm39) T507M possibly damaging Het
Lrp11 A G 10: 7,479,965 (GRCm39) H345R possibly damaging Het
Lrp6 A C 6: 134,456,502 (GRCm39) S921A probably benign Het
Lrrc27 A G 7: 138,822,614 (GRCm39) T502A probably benign Het
Marf1 A C 16: 13,970,321 (GRCm39) S133A probably benign Het
Mga C T 2: 119,733,538 (GRCm39) P129S probably damaging Het
Mgat4e T C 1: 134,469,063 (GRCm39) N327S probably damaging Het
Mlh1 A G 9: 111,068,866 (GRCm39) Y499H probably benign Het
Mrgpra1 A G 7: 46,985,218 (GRCm39) S154P probably damaging Het
Myo1h A G 5: 114,498,660 (GRCm39) I919V possibly damaging Het
Naalad2 T C 9: 18,262,214 (GRCm39) R442G probably damaging Het
Nat8f4 T C 6: 85,878,481 (GRCm39) H14R probably benign Het
Nav1 A G 1: 135,386,477 (GRCm39) S1184P probably damaging Het
Nckap1 T A 2: 80,337,278 (GRCm39) N986I probably benign Het
Ndufaf2 C G 13: 108,189,314 (GRCm39) A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,983,859 (GRCm39) probably benign Het
Nphp4 G A 4: 152,639,003 (GRCm39) R878K probably benign Het
Nutm1 G A 2: 112,079,281 (GRCm39) A878V probably benign Het
Or4f56 A T 2: 111,703,395 (GRCm39) D268E possibly damaging Het
Or52e8b A C 7: 104,673,737 (GRCm39) I150S probably damaging Het
Or5k1b G T 16: 58,580,911 (GRCm39) F209L probably damaging Het
Orc6 T A 8: 86,029,579 (GRCm39) I41K probably damaging Het
Ppp1r14a A T 7: 28,991,486 (GRCm39) E98V possibly damaging Het
Prpf8 T A 11: 75,383,331 (GRCm39) D521E probably damaging Het
Pudp A G 18: 50,701,136 (GRCm39) V199A probably damaging Het
Rab3c T C 13: 110,198,434 (GRCm39) E198G probably benign Het
Ramac T A 7: 81,418,163 (GRCm39) W73R probably damaging Het
Rbl2 A G 8: 91,812,196 (GRCm39) Y255C probably damaging Het
Rbm12 T C 2: 155,938,484 (GRCm39) D596G possibly damaging Het
Sipa1l3 A G 7: 29,077,066 (GRCm39) V902A probably damaging Het
Slc37a3 T G 6: 39,314,157 (GRCm39) Q485P probably benign Het
Slc44a3 T C 3: 121,320,723 (GRCm39) T93A possibly damaging Het
Slc66a1 G T 4: 139,027,312 (GRCm39) H343Q probably benign Het
Sun3 G A 11: 8,988,266 (GRCm39) L19F probably benign Het
Tas2r125 A G 6: 132,886,866 (GRCm39) I85V probably benign Het
Tenm4 A C 7: 96,423,253 (GRCm39) K683Q probably damaging Het
Tmprss11d C T 5: 86,454,140 (GRCm39) V222M probably damaging Het
Tnip1 A C 11: 54,806,365 (GRCm39) S570A possibly damaging Het
Top1mt G A 15: 75,529,552 (GRCm39) P554S probably damaging Het
Top1mt A G 15: 75,547,880 (GRCm39) F69L possibly damaging Het
Ttc7 A G 17: 87,648,325 (GRCm39) K508R probably benign Het
Ttll4 A T 1: 74,718,166 (GRCm39) T6S possibly damaging Het
Xpo5 T C 17: 46,533,643 (GRCm39) Y500H possibly damaging Het
Xpot C T 10: 121,450,968 (GRCm39) probably null Het
Zbbx T C 3: 74,992,348 (GRCm39) I268V probably benign Het
Zbtb40 G A 4: 136,734,408 (GRCm39) P360S probably damaging Het
Zfp324 T C 7: 12,705,233 (GRCm39) L474P probably damaging Het
Zfp398 A G 6: 47,817,186 (GRCm39) T9A probably benign Het
Zfp692 A C 11: 58,200,997 (GRCm39) S293R probably null Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATTTGTCTGTCTAATGTGTG -3'
(R):5'- GCCAAGCTCTACATCTCTCAATTAC -3'

Sequencing Primer
(F):5'- TGACTTGCTAACTTCTGTTG -3'
(R):5'- AATACCTAACACTCATT -3'
Posted On 2015-12-29